TkA08G020470 | RubberDandelionOmics

Gene overview

TkA08G020470

Reference: TK1151 Chr: Chr08 Coordinates: 5125696-5129848 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1804 bp · TkA08G020470|TK1151|cDNA

ACGATTGGGTTTGCCCTATTTGTTGGATTTGTTCGATCGGAGAATGGTCGATCGAAGCGTCGTTCTGCACTTGCAACAACGGTTGCTGCACTTGCAAGGATGACTCGTGAAGATTCAAAAACGTTGCTCACAAAAGAGTATTATCCTTCGTGGGTTGTTTTCTCACAGAAACAAAAGTTGGCTTGGCTTAATTCTCATCTTACAAAGATCTGGCCCTATGTTGATGAGGCAGCTTCTGAGCTTATAAAGGCTAATGTGGA...

CDS

Download CDS FASTA

1089 bp · TkA08G020470|TK1151|CDS

ACGATTGGGTTTGCCCTATTTGTTGGATTTGTTCGATCGGAGAATGGTCGATCGAAGCGTCGTTCTGCACTTGCAACAACGGTTGCTGCACTTGCAAGGATGACTCGTGAAGATTCAAAAACGTTGCTCACAAAAGAGTATTATCCTTCGTGGGTTGTTTTCTCACAGAAACAAAAGTTGGCTTGGCTTAATTCTCATCTTACAAAGATCTGGCCCTATGTTGATGAGGCAGCTTCTGAGCTTATAAAGGCTAATGTGGA...

Protein

Download Protein FASTA

362 aa · TkA08G020470|TK1151|PROTEIN

TIGFALFVGFVRSENGRSKRRSALATTVAALARMTREDSKTLLTKEYYPSWVVFSQKQKLAWLNSHLTKIWPYVDEAASELIKANVEPVLEQYRPIILSSLTFSKLTLGTVAPQFTGVCVIEDESDGITLELEMNWDGNPSIVLDVKTRLGVGLPVQVKDIAFTGVFRLIFKPLVNEFPCFGAVSFSLRKKTKMDFTLKVIGGDISAIPGVADALESTIHDAVEDSITWPVRKVIPILPGDYSDLELKPMGILEVKLVQA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G020470`
TK1151 ID	TkA08G020470
OH-1004 ID	LXL04_018202
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	97.200
Protein coverage (%)	TK1151 98.619 / OH-1004 63.458 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G020470

Location Chr08:5125696-5129848 (+)

Description Similar to SYT5: Synaptotagmin-5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g05500`	May be involved in membrane trafficking.	No verified direct reference in this release
`At5g11100`	May be involved in membrane trafficking.	No verified direct reference in this release
`At3g61050`	May be involved in membrane trafficking (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018202 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006612 protein targeting to membrane Biological Process

GO:0006869 lipid transport Biological Process

GO:0006897 endocytosis Biological Process

GO:0007029 endoplasmic reticulum organization Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009612 response to mechanical stimulus Biological Process

GO:0009615 response to virus Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009958 positive gravitropism Biological Process

GO:0032456 endocytic recycling Biological Process

KEGG gene cross-reference

ath:AT1G05500

ath:AT2G20990

ath:AT3G61050

ath:AT5G11100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.596

Rank 1 · TkA08G020470 · TK1151

Cytoplasm0.247

Rank 2 · TkA08G020470 · TK1151

Endoplasmic reticulum0.159

Rank 3 · TkA08G020470 · TK1151

Golgi apparatus0.120

Rank 4 · TkA08G020470 · TK1151

Lysosome / Vacuole0.099

Rank 5 · TkA08G020470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF17047SMP_LBD59-237 aa

PF25669SMP_MUG190-like61-125 aa

PF26547PDZD8_N95-234 aa

PF25669SMP_MUG190-like142-225 aa

PF00168C2251-355 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G020470	`PF17047`	SMP_LBD	59	237	1.8e-14	54.4
TkA08G020470	`PF25669`	SMP_MUG190-like	61	125	2.3e-08	34.6
TkA08G020470	`PF26547`	PDZD8_N	95	234	0.00051	20.6
TkA08G020470	`PF25669`	SMP_MUG190-like	142	225	2.3e-08	34.6
TkA08G020470	`PF00168`	C2	251	355	1.7e-26	93.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L706`	Arabidopsis thaliana	sp\|Q8L706\|SYT5_ARATH Synaptotagmin-5	77.300%	Swiss-Prot	High
`A0JJX5`	Arabidopsis thaliana	sp\|A0JJX5\|SYT4_ARATH Synaptotagmin-4	69.000%	Swiss-Prot	High
`Q9LEX1`	Arabidopsis thaliana	sp\|Q9LEX1\|CLB_ARATH Calcium-dependent lipid-binding protein	44.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card