LXL04_018202 | RubberDandelionOmics

Gene overview

LXL04_018202

Reference: OH-1004 Chr: Chr04 Coordinates: 8576141-8580165 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1686 bp · LXL04_018202|LXL04_018202|OH1004|cDNA

ATGTCGTTCGTTGTGGGGTTGATAATCGGGATTACGATTGGGTTTGCCCTAATTGTTGGATTTGTTCGATCGGAGAATGGTCGATCGAAGCGTCGTTCTGCACTTGCAACAACGGTTGCCGCACTTGCAAGGATGACTCGTGAAGATTCAAAAAAGTTGCTCACAAACGAGTATTATCCTTCGTGGGTTGTTTTCTCACAGAAACAAAAGTTAAGTTTGGCTTGGCTTAATTCTCATCTTACAAAGATCTGGCCCTATGT...

CDS

Download CDS FASTA

1686 bp · LXL04_018202|LXL04_018202|OH1004|CDS

ATGTCGTTCGTTGTGGGGTTGATAATCGGGATTACGATTGGGTTTGCCCTAATTGTTGGATTTGTTCGATCGGAGAATGGTCGATCGAAGCGTCGTTCTGCACTTGCAACAACGGTTGCCGCACTTGCAAGGATGACTCGTGAAGATTCAAAAAAGTTGCTCACAAACGAGTATTATCCTTCGTGGGTTGTTTTCTCACAGAAACAAAAGTTAAGTTTGGCTTGGCTTAATTCTCATCTTACAAAGATCTGGCCCTATGT...

Protein

Download Protein FASTA

561 aa · LXL04_018202|LXL04_018202|OH1004|PROTEIN

MSFVVGLIIGITIGFALIVGFVRSENGRSKRRSALATTVAALARMTREDSKKLLTNEYYPSWVVFSQKQKLSLAWLNSHLTKIWPYVDEAASELIKANVEPVLEQYRPIILSSLTFSKLTLGTVAPQFTGVCVIEDESDGITLELEMNWDGNPSIVLDVKTRLGVGLPVQVKDISFTGVFRLIFKPLVNEFPCFGAVSFSLRKKTKMDFTLKVIGSAIPGVADALESTIHDAVEDSITWPVRKVIPILPGDYSDLELKPM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018202`
TK1151 ID	TkA08G020470
OH-1004 ID	LXL04_018202
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	97.200
Protein coverage (%)	TK1151 98.619 / OH-1004 63.458 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018202

Location Chr04:8576141-8580165 (-)

Description Similar to SYT5: Synaptotagmin-5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g05500`	May be involved in membrane trafficking.	No verified direct reference in this release
`At5g11100`	May be involved in membrane trafficking.	No verified direct reference in this release
`At3g61050`	May be involved in membrane trafficking (By similarity).	No verified direct reference in this release
`At2g20990`	Plays an important role in maintaining plasma membrane integrity during freezing and osmotic stresses.	Arabidopsis synaptotagmin 1 is required for the maintenance of plasma membrane integrity and cell viability.2008 · DOI: 10.1105/tpc.108.063859 Calcium-dependent freezing tolerance in Arabidopsis involves membrane resealing via synaptotagmin SYT1.2008 · DOI: 10.1105/tpc.108.062679 Arabidopsis synaptotagmin SYTA regulates endocytosis and virus movement protein cell-to-cell transport.2010 · DOI: 10.1073/pnas.0909080107 Arabidopsis synaptotagmin SYT1, a type I signal-anchor protein, requires tandem C2 domains for delivery to the plasma membrane.2010 · DOI: 10.1074/jbc.m109.084046
`At1g20080`	May play an important role in regulating an unconventional protein trafficking from the cytosol to the extracellular matrix.	Golgi apparatus-localized synaptotagmin 2 is required for unconventional secretion in Arabidopsis.2011 · DOI: 10.1371/journal.pone.0026477

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018202 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006612 protein targeting to membrane Biological Process

GO:0006869 lipid transport Biological Process

GO:0006897 endocytosis Biological Process

GO:0007029 endoplasmic reticulum organization Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009612 response to mechanical stimulus Biological Process

GO:0009615 response to virus Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009958 positive gravitropism Biological Process

GO:0032456 endocytic recycling Biological Process

KEGG gene cross-reference

ath:AT1G05500

ath:AT2G20990

ath:AT3G61050

ath:AT5G11100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.455

Rank 1 · LXL04_018202 · OH-1004

Cytoplasm0.207

Rank 2 · LXL04_018202 · OH-1004

Endoplasmic reticulum0.193

Rank 3 · LXL04_018202 · OH-1004

Golgi apparatus0.151

Rank 4 · LXL04_018202 · OH-1004

Lysosome / Vacuole0.136

Rank 5 · LXL04_018202 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25669.2SMP_MUG190-like72-137 aa

PF17047.12SMP_LBD74-247 aa

PF00168.37C2261-365 aa

PF00168.37C2436-531 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018202	`PF25669.2`	SMP_MUG190-like	72	137	8.5e-07	29.4
LXL04_018202	`PF17047.12`	SMP_LBD	74	247	1.7e-13	51.2
LXL04_018202	`PF00168.37`	C2	261	365	1.3e-54	183.5
LXL04_018202	`PF00168.37`	C2	436	531	1.3e-54	183.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L706`	Arabidopsis thaliana	Synaptotagmin-5	72.807%	Swiss-Prot	strong database homology
`A0JJX5`	Arabidopsis thaliana	Synaptotagmin-4	64.912%	Swiss-Prot	strong database homology
`Q9LEX1`	Arabidopsis thaliana	Calcium-dependent lipid-binding protein	41.218%	Swiss-Prot	moderate database homology
`Q9SKR2`	Arabidopsis thaliana	Synaptotagmin-1	30.864%	Swiss-Prot	moderate database homology
`B6ETT4`	Arabidopsis thaliana	Synaptotagmin-2	29.965%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card