TkA08G005960 | RubberDandelionOmics

Gene overview

TkA08G005960

Reference: TK1151 Chr: Chr08 Coordinates: 1518824-1522764 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1240 bp · TkA08G005960|TK1151|cDNA

TTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTAAGAACTCAGTTAGAAGTTTAGCCATGGTGATCAAACTAGAGAAAACTCTATCAACGGCCTTGAATGCAAAAATCATAGGTTCAGGAAAAGAAACTCTGGTTCTAGCTCATGGCTATGGCGGAGACCAGTCTGTTTGGGACAAGGTTCTTCCGGTACTCACTCAGAGCTACCAAGTTGTTGTTTTCGACTGGAGCTTCTCCGGCGCCATTAAAGATCCAAA...

CDS

Download CDS FASTA

819 bp · TkA08G005960|TK1151|CDS

ATGGTGATCAAACTAGAGAAAACTCTATCAACGGCCTTGAATGCAAAAATCATAGGTTCAGGAAAAGAAACTCTGGTTCTAGCTCATGGCTATGGCGGAGACCAGTCTGTTTGGGACAAGGTTCTTCCGGTACTCACTCAGAGCTACCAAGTTGTTGTTTTCGACTGGAGCTTCTCCGGCGCCATTAAAGATCCAAACACCCTCTTTGATCCTGCCAAATATTGCTCTTATGATGCTTTTTCAGATGACCTTACCGCCCT...

Protein

Download Protein FASTA

272 aa · TkA08G005960|TK1151|PROTEIN

MVIKLEKTLSTALNAKIIGSGKETLVLAHGYGGDQSVWDKVLPVLTQSYQVVVFDWSFSGAIKDPNTLFDPAKYCSYDAFSDDLTALLEELNLVSTVFVGHSMSGMIGCIASIKKPHLFKRLILIGSSPRYVNSESYDGGFDIKDIEQLFSSIESNYDGWSSIFPSLVIDNNDSESVKSFEKCLKRMKSDIALSTARTVFLSDHCDILEKVVIPCSLVQTTSDIVVPFSVVEYMNQMIKGESTVEMIDTVGHFPQLTAPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G005960`
TK1151 ID	TkA08G005960
OH-1004 ID	LXL04_018316
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 93.015 / OH-1004 48.099 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G005960

Location Chr08:1518824-1522764 (+)

Description Similar to D14: Strigolactone esterase D14

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g03990`	Involved in strigolactone signaling pathway.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0203200`	Involved in strigolactone (SL) signaling pathway.	Identification and characterization of HTD2: a novel gene negatively regulating tiller bud outgrowth in rice.2009 · DOI: 10.1007/s00425-009-0975-6

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018316 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010223 secondary shoot formation Biological Process

GO:1901601 strigolactone biosynthetic process Biological Process

GO:1902347 response to strigolactone Biological Process

GO:1902348 cellular response to strigolactone Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0016787 hydrolase activity Molecular Function

GO:0016788 hydrolase activity, acting on ester bonds Molecular Function

KEGG gene cross-reference

ath:AT3G03990

dosa:Os03g0203200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.737

Rank 1 · TkA08G005960 · TK1151

Nucleus0.491

Rank 2 · TkA08G005960 · TK1151

Mitochondrion0.040

Rank 3 · TkA08G005960 · TK1151

Lysosome / Vacuole0.032

Rank 4 · TkA08G005960 · TK1151

Cell membrane0.031

Rank 5 · TkA08G005960 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12146Hydrolase_422-252 aa

PF00561Abhydrolase_124-259 aa

PF12697Abhydrolase_625-261 aa

PF03096Ndr59-264 aa

PF00756Esterase96-124 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G005960	`PF12146`	Hydrolase_4	22	252	3.9e-06	27.1
TkA08G005960	`PF00561`	Abhydrolase_1	24	259	1.3e-19	71.6
TkA08G005960	`PF12697`	Abhydrolase_6	25	261	1.8e-11	45.8
TkA08G005960	`PF03096`	Ndr	59	264	0.0069	15.9
TkA08G005960	`PF00756`	Esterase	96	124	0.29	11.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SQR3`	Arabidopsis thaliana	sp\|Q9SQR3\|D14_ARATH Strigolactone esterase D14	42.900%	Swiss-Prot	Medium
`Q10QA5`	Oryza sativa subsp. japonica	sp\|Q10QA5\|D14_ORYSJ Strigolactone esterase D14	41.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card