TkA07G397200 | RubberDandelionOmics

Gene overview

TkA07G397200

Reference: TK1151 Chr: Chr07 Coordinates: 99767735-99769816 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1485 bp · TkA07G397200|TK1151|cDNA

CGGGTTTCTAACGCATATGCTTTGCACCTTTTTTGGCAAGACTAAGAAGATACAGCCTACAGGGGATACAAATAGGGGTGGGGAGGGGTCTAATGGCGTGAAGAGGAGAAAGCCAATGACGTTTGGGAAAGCGAGATAAAAAGAGATCCAAGATCATCATGTTGAAGAAGAGCCACCTTTCGATTTGGATCTGAGCTGGGCGATTGAAAACCCGATCTGGGGTTGTCTATTCGCGACGTCAGATGGAGGAAACGAAATTG...

CDS

Download CDS FASTA

1023 bp · TkA07G397200|TK1151|CDS

ATGGAGGAAACGAAATTGTGCTCATGGACGGTGTTTCGATCCGTTTTCGCTATCTTTCAGTGGTGGAGCTTCAATGTCGCCGTCATCATCATGAACAAATGGATCTTTCAGAAACTCGATTTCAAGTTCCCTTTGACGGTATCATGTGTACACTTCATATGCTCATCGATTGGGGCATACGTGGTCATCGTAGTCCTCAAGGTAAAACCACTAATCTCAGTCGAACCCGAAGATCGCTGGAGAAGGATCTTCCCAATGTC...

Protein

Download Protein FASTA

340 aa · TkA07G397200|TK1151|PROTEIN

MEETKLCSWTVFRSVFAIFQWWSFNVAVIIMNKWIFQKLDFKFPLTVSCVHFICSSIGAYVVIVVLKVKPLISVEPEDRWRRIFPMSFVFCINIVLGNVSLRYIPVSFMQTIKSFTPATTVILQWMVWRKYFDWRIWASLVPIVGGILLTSVTELSFNAFGFCAALFGCLATSTKTILAESLLHGYKFDSINTVYYMAPFATMILAVPALLLEGPGVVEWIRTAPNLSSSFIIIFGSGVTAFCLNFSIFYVIHSTTAVTF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G397200`
TK1151 ID	TkA07G397200
OH-1004 ID	LXL04_036232
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	35.400
Protein coverage (%)	TK1151 85.294 / OH-1004 91.536 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G397200

Location Chr07:99767735-99769816 (-)

Description Similar to UUAT1: UDP-URONIC ACID TRANSPORTER 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g21870`	GDP-mannose transporter that may be involved in the import of GDP-mannose from the cytoplasm into the Golgi lumen.	Arabidopsis thaliana expresses multiple Golgi-localised nucleotide-sugar transporters related to GONST1.2004 · DOI: 10.1007/s00438-004-1071-z
`At1g77610`	Nucleotide sugar transporter that specifically transports UDP-galactose.	Molecular cloning of two Arabidopsis UDP-galactose transporters by complementation of a deficient Chinese hamster ovary cell line.2005 · DOI: 10.1093/glycob/cwh159
`At5g05820`	Probable sugar phosphate/phosphate translocator At5g05820.	No verified direct reference in this release
`At5g04160`	UDP-glucuronic acid transporter that modulates the polysaccharide composition of seed mucilage.	UUAT1 Is a Golgi-Localized UDP-Uronic Acid Transporter That Modulates the Polysaccharide Composition of Arabidopsis Seed Mucilage.2017 · DOI: 10.1105/tpc.16.00465
`At3g11320`	Probable sugar phosphate/phosphate translocator At3g11320.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036232 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0015780 nucleotide-sugar transmembrane transport Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0015297 antiporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G12500

ath:AT3G10290

ath:AT3G11320

ath:AT5G04160

ath:AT5G05820

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.615

Rank 1 · TkA07G397200 · TK1151

Endoplasmic reticulum0.155

Rank 2 · TkA07G397200 · TK1151

Cytoplasm0.149

Rank 3 · TkA07G397200 · TK1151

Cell membrane0.078

Rank 4 · TkA07G397200 · TK1151

Lysosome / Vacuole0.066

Rank 5 · TkA07G397200 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08449UAA15-303 aa

PF03151TPT17-301 aa

PF00892EamA44-151 aa

PF00892EamA160-300 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G397200	`PF08449`	UAA	15	303	1.2e-10	41.8
TkA07G397200	`PF03151`	TPT	17	301	3.1e-50	171.9
TkA07G397200	`PF00892`	EamA	44	151	4.6e-17	63.3
TkA07G397200	`PF00892`	EamA	160	300	4.6e-17	63.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SFE9`	Arabidopsis thaliana	sp\|Q9SFE9\|GONS5_ARATH GDP-mannose transporter GONST5	80.600%	Swiss-Prot	High
`Q9C521`	Arabidopsis thaliana	sp\|Q9C521\|UGAL1_ARATH UDP-galactose transporter 1	82.500%	Swiss-Prot	High
`Q6DBP3`	Arabidopsis thaliana	sp\|Q6DBP3\|PT505_ARATH Probable sugar phosphate/phosphate translocator At5g05820	33.800%	Swiss-Prot	Medium
`Q9FYE5`	Arabidopsis thaliana	sp\|Q9FYE5\|UUAT1_ARATH UDP-URONIC ACID TRANSPORTER 1	33.300%	Swiss-Prot	Medium
`Q5XF09`	Arabidopsis thaliana	sp\|Q5XF09\|PT311_ARATH Probable sugar phosphate/phosphate translocator At3g11320	32.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card