TkA07G286540 | RubberDandelionOmics

Gene overview

TkA07G286540

Reference: TK1151 Chr: Chr07 Coordinates: 71922472-71925937 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2160 bp · TkA07G286540|TK1151|cDNA

AATACACGGCTGTACTTGCTCTTACAGACTTACACCCAAGGTGTTCGCATAAATATTAAGAACCACGGGAATCTCCTTTTCCATGAAACCTTTCTTCCATTATTCTACAGAATACTGCATTCCTCAACACCAATGGCGACCTTCTCCAAAACCCAATTAAATTACCCCCATTCTTCAACAAAAACTTCAAATTTTGAAATGTCAGAGAACCAATCCTTGTCCCACGACTGGTATTTTGAAGAGACAGGAGTATACAACAG...

CDS

Download CDS FASTA

1848 bp · TkA07G286540|TK1151|CDS

AATACACGGCTGTACTTGCTCTTACAGACTTACACCCAAGGTGTTCGCATAAATATTAAGAACCACGGGAATCTCCTTTTCCATGAAACCTTTCTTCCATTATTCTACAGAATACTGCATTCCTCAACACCAATGGCGACCTTCTCCAAAACCCAATTAAATTACCCCCATTCTTCAACAAAAACTTCAAATTTTGAAATGTCAGAGAACCAATCCTTGTCCCACGACTGGTATTTTGAAGAGACAGGAGTATACAACAG...

Protein

Download Protein FASTA

615 aa · TkA07G286540|TK1151|PROTEIN

NTRLYLLLQTYTQGVRINIKNHGNLLFHETFLPLFYRILHSSTPMATFSKTQLNYPHSSTKTSNFEMSENQSLSHDWYFEETGVYNSRHPRIDIPSDPFLDVVSCVFSHKHNGKTALIDAASGVSISYAELQPLVKSMASGLHHQMGVSKGDVVLILLPNSIYYPIILLGVLYLGAVVSTMNPFSSFSEIKKQTLGCHVTLAFTFPNKADELSSLGIESILVPENTKFDSNQFRFTPFYKLISSDHELVPRRTVTLDDTA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G286540`
TK1151 ID	TkA07G286540
OH-1004 ID	LXL04_029219
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 99.512 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G286540

Location Chr07:71922472-71925937 (+)

Description Similar to 4CLL6: 4-coumarate--CoA ligase-like 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g19010`	Contributes to jasmonic acid biosynthesis by initiating the beta-oxidative chain shortening of its precursors.	The Origin and Biosynthesis of the Benzenoid Moiety of Ubiquinone (Coenzyme Q) in Arabidopsis.2014 · DOI: 10.1105/tpc.114.125807

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0143300`	Carboxylate--CoA ligase that may use 4-coumarate as substrate.	No verified direct reference in this release
`Os10g0578950`	Carboxylate--CoA ligase that may use 4-coumarate as substrate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029219 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006744 ubiquinone biosynthetic process Biological Process

GO:0009698 phenylpropanoid metabolic process Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:0042617 paclitaxel biosynthetic process Biological Process

GO:0005777 peroxisome Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016207 4-coumarate-CoA ligase activity Molecular Function

GO:0016405 CoA-ligase activity Molecular Function

GO:0018859 4-hydroxybenzoate-CoA ligase activity Molecular Function

KEGG gene cross-reference

ag:AKA59704

ath:AT4G19010

dosa:Os08g0143300

osa:9269113

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.492

Rank 1 · TkA07G286540 · TK1151

Cytoplasm0.168

Rank 2 · TkA07G286540 · TK1151

Mitochondrion0.130

Rank 3 · TkA07G286540 · TK1151

Plastid0.112

Rank 4 · TkA07G286540 · TK1151

Endoplasmic reticulum0.096

Rank 5 · TkA07G286540 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00501AMP-binding109-475 aa

PF27289YomX_N469-517 aa

PF13193AMP-binding_C527-601 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G286540	`PF00501`	AMP-binding	109	475	2.2e-85	287.5
TkA07G286540	`PF27289`	YomX_N	469	517	0.19	12.4
TkA07G286540	`PF13193`	AMP-binding_C	527	601	7.3e-19	69.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84P24`	Arabidopsis thaliana	sp\|Q84P24\|4CLL6_ARATH 4-coumarate--CoA ligase-like 6	60.500%	Swiss-Prot	High
`Q6YYZ2`	Oryza sativa subsp. japonica	sp\|Q6YYZ2\|4CLL3_ORYSJ 4-coumarate--CoA ligase-like 3	52.300%	Swiss-Prot	High
`Q336M7`	Oryza sativa subsp. japonica	sp\|Q336M7\|4CLL2_ORYSJ 4-coumarate--CoA ligase-like 2	53.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card