TkA07G255420 | RubberDandelionOmics

Gene overview

TkA07G255420

Reference: TK1151 Chr: Chr07 Coordinates: 63846406-63848424 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

816 bp · TkA07G255420|TK1151|cDNA

AAAAAATTTGCAGCTTGTGATGGGGTTCCTTGGCCGGTGACTAGAAAAATGGGGAAGGGGCCGACGAGGTCACAGGCAACTATAAAGAAGCCGACATTCACCAGCCGGTGAGTTACATCGCTACATTCGTGCAGGAACATGGAGTCGTCGTCATCATCATCATCTAGCCGCCGCAGGCAATCACCCTATTCTAATCTCAATCAAGAACGCTTTCTACGAAAGCACTTAAGGCCAGCAATTACGGGCAAATCGTGCCCAAT...

CDS

Download CDS FASTA

879 bp · TkA07G255420|TK1151|CDS

ATGGAGTCGTCGTCATCATCATCATCTAGCCGCCGCAGGCAATCACCCTATTCTAATCTCAATCAAGAACGCTTTCTACGAAAGCACTTAAGGCCAGCAATTACGGGCAAATCGTGCCCAATTTGTTTAAGCCTAATCGAAGAAGCAGCTGTAATTACTGTATGTTTGCACGCCTACTGCGCCGATTGCATTCGTAAATGGAGTAATCTGAAAAGAAAGTGTCCCCTTTGTAATGCTCAGTACGGTTCGCTGTTCGTCGT...

Protein

Download Protein FASTA

292 aa · TkA07G255420|TK1151|PROTEIN

MESSSSSSSSRRRQSPYSNLNQERFLRKHLRPAITGKSCPICLSLIEEAAVITVCLHAYCADCIRKWSNLKRKCPLCNAQYGSLFVVIDLNSRTFHTKHLSAPRETKFNNNIGHSNGRQRNFIAQRRAIGISREELNAVNRRTRTLPRQRSFGQTKVLPPGVINERILQWRASIYEEKLHAVPCPTRRPIEQGLMGIKGNKERVVERIQPWIHRELHAVLGDPDPAILVHLVTSLFISALEFPSENKHVETLRPFFMEKT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G255420`
TK1151 ID	TkA07G255420
OH-1004 ID	LXL04_028967
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G255420`
Location	Chr07:63846406-63848424 (+)
Description	Similar to Topors: E3 ubiquitin-protein ligase Topors
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_028967` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000209 protein polyubiquitination Biological Process GO:0006325 chromatin organization Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0006513 protein monoubiquitination Biological Process GO:0006974 DNA damage response Biological Process GO:0006997 nucleus organization Biological Process GO:0007060 male meiosis chromosome segregation Biological Process GO:0010032 meiotic chromosome condensation Biological Process GO:0016925 protein sumoylation Biological Process GO:0019046 release from viral latency Biological Process
KEGG gene cross-reference	dme:Dmel_CG15104 hsa:10210 mmu:106021 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.878

Rank 1 · TkA07G255420 · TK1151

Cytoplasm0.193

Rank 2 · TkA07G255420 · TK1151

Cell membrane0.025

Rank 3 · TkA07G255420 · TK1151

Endoplasmic reticulum0.016

Rank 4 · TkA07G255420 · TK1151

Mitochondrion0.015

Rank 5 · TkA07G255420 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13920zf-C3HC4_337-80 aa

PF12678zf-rbx137-78 aa

PF18112Zn-C2H2_1237-42 aa

PF17120zf-RING_1637-75 aa

PF15750UBZ_FAAP2037-43 aa

PF13639zf-RING_238-78 aa

PF16685zf-RING_1038-80 aa

PF12861zf-ANAPC1138-80 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G255420	`PF13920`	zf-C3HC4_3	37	80	1.3e-06	28.8
TkA07G255420	`PF12678`	zf-rbx1	37	78	7.8e-06	26.8
TkA07G255420	`PF18112`	Zn-C2H2_12	37	42	0.2	12.8
TkA07G255420	`PF17120`	zf-RING_16	37	75	0.39	11.1
TkA07G255420	`PF15750`	UBZ_FAAP20	37	43	0.44	11.1
TkA07G255420	`PF13639`	zf-RING_2	38	78	3.1e-09	37.6
TkA07G255420	`PF16685`	zf-RING_10	38	80	0.0056	17.5
TkA07G255420	`PF12861`	zf-ANAPC11	38	80	0.015	16.0
TkA07G255420	`PF11789`	zf-Nse	38	77	0.66	10.6
TkA07G255420	`PF06906`	DUF1272	38	79	0.74	10.7
TkA07G255420	`PF14447`	Prok-RING_4	38	48	0.86	10.3
TkA07G255420	`PF13923`	zf-C3HC4_2	39	77	3.7e-10	40.1
TkA07G255420	`PF00097`	zf-C3HC4	39	77	1.6e-09	38.2
TkA07G255420	`PF13445`	zf-RING_UBOX	39	75	2e-07	31.6
TkA07G255420	`PF14634`	zf-RING_5	39	78	1.8e-06	28.5
TkA07G255420	`PF15227`	zf-C3HC4_4	39	77	0.0045	17.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card