TkA07G110500 | RubberDandelionOmics

Gene overview

TkA07G110500

Reference: TK1151 Chr: Chr07 Coordinates: 28614043-28617951 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2394 bp · TkA07G110500|TK1151|cDNA

AACTCTCATCTTACCCATACGATCAGAATACTAACACTTTATCTACCGTCGATTATTTAAAAAAATTGAAATTCAAAAGCTCAAGAGAGGGAGGAGCAAGGCAAAGAAAATAAGTCTATATTTTTGCTCCTCTATTTCTCCCACCTCAATCTTTCTCGTCTCAATCACATCTAAAGATTGCTGTTTTCCCACGTAGAGTTACTGGGTTTAGAGTTTAGACGATTCTATTTGTGGGTTTGGTGTTGATTTGGGGTTAATCT...

CDS

Download CDS FASTA

1119 bp · TkA07G110500|TK1151|CDS

ATGCAATTGCAAGAAGTCAGGGTGTTTGAAGAAATACTGGAGTGTTTTCAAGCAAACATTCTTTGTTCTGAGATGTGTAGATGCATGGATTGCAAGAACTTTGATGGAAGTGAAGAAAGACAAGCTCTTTTTCATGGAGATTGCGGGAGTCACATCTCGCATCTTCAACTGGCGGCAAATGCCGCCATCACCGGAGCTGTTGGGGCCTCCGGTTACGGTTCGCCGCCAGTGTACCGGAAAAGAAAGGGCCCGGAGGTTTT...

Protein

Download Protein FASTA

372 aa · TkA07G110500|TK1151|PROTEIN

MQLQEVRVFEEILECFQANILCSEMCRCMDCKNFDGSEERQALFHGDCGSHISHLQLAANAAITGAVGASGYGSPPVYRKRKGPEVLIGGHESKDSVFHRVAHFHQANNVKESTPSSSWPSVPGARVVNNASVGPSKFAYRSLLADVIRSDDMKELCAVLVVYASEAARMLSDEANAKEKTTNNNTESSLTSSITDLQQSPKESDAQKPMADESSSDAGEGGSKLRPMSPGTLALMCDEHDSVFINSSSNGFVDHHVDNY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G110500`
TK1151 ID	TkA07G110500
OH-1004 ID	LXL04_027978
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.400
Protein coverage (%)	TK1151 96.505 / OH-1004 62.544 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G110500

Location Chr07:28614043-28617951 (+)

Description Similar to TCX5: Protein tesmin/TSO1-like CXC 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g29000`	Plays a role in development of both male and female reproductive tissues.	No verified direct reference in this release
`At2g20110`	Plays a role in development of both male and female reproductive tissues.	No verified direct reference in this release
`At5g25790`	Plays a role in development of both male and female reproductive tissues.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027978 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000122 negative regulation of transcription by RNA polymerase II Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0007307 eggshell chorion gene amplification Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0031523 Myb complex Cellular Component

GO:0070176 DRM complex Cellular Component

GO:0000987 cis-regulatory region sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G20110

ath:AT3G16160

ath:AT4G29000

ath:AT5G25790

dme:Dmel_CG6061

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.950

Rank 1 · TkA07G110500 · TK1151

Cytoplasm0.172

Rank 2 · TkA07G110500 · TK1151

Cell membrane0.022

Rank 3 · TkA07G110500 · TK1151

Mitochondrion0.018

Rank 4 · TkA07G110500 · TK1151

Endoplasmic reticulum0.009

Rank 5 · TkA07G110500 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03638TCR14-33 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G110500	`PF03638`	TCR	14	33	0.00022	22.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SZD1`	Arabidopsis thaliana	sp\|Q9SZD1\|TCX5_ARATH Protein tesmin/TSO1-like CXC 5	50.200%	Swiss-Prot	High
`Q9SL70`	Arabidopsis thaliana	sp\|Q9SL70\|TCX6_ARATH Protein tesmin/TSO1-like CXC 6	47.200%	Swiss-Prot	Medium
`F4JY84`	Arabidopsis thaliana	sp\|F4JY84\|TCX7_ARATH Protein tesmin/TSO1-like CXC 7	34.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card