TkA07G084930 | RubberDandelionOmics

Gene overview

TkA07G084930

Reference: TK1151 Chr: Chr07 Coordinates: 22188047-22192111 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1073 bp · TkA07G084930|TK1151|cDNA

TAACTCTCCAAACAAATTACTGGAACTCATCGCCTCCATCCTTTCGTCGCTAGCAGCATCCGATCGAAGCCAAACTCACCGGCCGCCGCATTGAACATTGAACGAGAGATAAATTTCTCGTCTTTCTCCTGTATTGTCATCTCCCGCTTCGATACGAGAGGTACAATTTTCGGGGAATGTTTTTTGTCCAACTTCAAGAGAGAGATGAGCTTGTTTCAAAGGTGTGCCTACATAGTACAAGAAGCACTTGACAAAAGCTT...

CDS

Download CDS FASTA

537 bp · TkA07G084930|TK1151|CDS

ATGAGCTTGTTTCAAAGGTGTGCCTACATAGTACAAGAAGCACTTGACAAAAGCTTTTCGGTTGCCAAATTCTTTTGTGCAATTCATGTCACCAATACCTACCTTTTCTCCACTGCTTTGGTGCAAGGTCCTAGTATGCTCCCCACCTTCAACCTTAACGGTGAGATTGTCCTACTTGATAGAATCTCAACCAGATATGGGAAAGTGGGTCCCGGTGATGTCATTATAGTCCGTTCGCCTGAAAGTCCAAGAAAAGTTGT...

Protein

Download Protein FASTA

178 aa · TkA07G084930|TK1151|PROTEIN

MSLFQRCAYIVQEALDKSFSVAKFFCAIHVTNTYLFSTALVQGPSMLPTFNLNGEIVLLDRISTRYGKVGPGDVIIVRSPESPRKVVTKRIIGMEGDTITYIVDPKNSDTTETIVVPKGHVWVEGDNIYNTYDSRNFGPVPYGLLQGKVFWKIWPTSAFGSIGRRPQSVDPALKVMEQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G084930`
TK1151 ID	TkA07G084930
OH-1004 ID	LXL04_001902
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	57.900
Protein coverage (%)	TK1151 89.326 / OH-1004 97.546 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G084930

Location Chr07:22188047-22192111 (-)

Description Similar to immp1l: Mitochondrial inner membrane protease subunit 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g53530`	Catalyzes the removal of transit peptides required for the targeting of proteins from the mitochondrial matrix, across the inner membrane, into the inter-membrane space.	No verified direct reference in this release
`At1g23465`	Catalyzes the removal of transit peptides required for the targeting of proteins from the mitochondrial matrix, across the inner membrane, into the inter-membrane space.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_001902 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006465 signal peptide processing Biological Process

GO:0006627 protein processing involved in protein targeting to mitochondrion Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0042720 mitochondrial inner membrane peptidase complex Cellular Component

GO:0004175 endopeptidase activity Molecular Function

GO:0004252 serine-type endopeptidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G23465

ath:AT1G53530

hsa:196294

mmu:66541

xtr:549343

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.951

Rank 1 · TkA07G084930 · TK1151

Cytoplasm0.051

Rank 2 · TkA07G084930 · TK1151

Nucleus0.046

Rank 3 · TkA07G084930 · TK1151

Cell membrane0.024

Rank 4 · TkA07G084930 · TK1151

Endoplasmic reticulum0.022

Rank 5 · TkA07G084930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10502Peptidase_S2625-101 aa

PF00717Peptidase_S2439-118 aa

PF10502Peptidase_S26112-154 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G084930	`PF10502`	Peptidase_S26	25	101	4e-23	82.9
TkA07G084930	`PF00717`	Peptidase_S24	39	118	0.006	17.0
TkA07G084930	`PF10502`	Peptidase_S26	112	154	4e-23	82.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6NLT8`	Arabidopsis thaliana	sp\|Q6NLT8\|IMP1A_ARATH Mitochondrial ATP-independent inner membrane protease subunit 1a	52.300%	Swiss-Prot	High
`Q5BIV4`	Arabidopsis thaliana	sp\|Q5BIV4\|IMP1B_ARATH Mitochondrial ATP-independent inner membrane protease subunit 1b	51.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card