RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G077520
Reference: TK1151 Chr: Chr07 Coordinates: 20169225-20181442 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

6630 bp · TkA07G077520|TK1151|cDNA

TGGGATTTCAAATCCATACCCCGGGCCGGCAAGCCCTCACCTGACCTAACACCCCAATACATAAAACTGAAATTTCATCCCCTCCCGACATTCCCCCAAATCTCCCTCTTAATATCTTTATTCGTTTCAAATTGGGGGAGAAATCAACCCCAAAGACGTTATGTTCTTCTTCCCACACACTACAAGTTACAGACTTCGATTTGATCGCCATTTGTATCTAGAACACATATATACATATCTATTCATCTATATAACTTGTA...

CDS

Download CDS FASTA

3111 bp · TkA07G077520|TK1151|CDS

ATGAGAGAATCTGCTTTGGCAGCTTTGGATTCTTGGGTTGCTGCCACTCACCTTGATAAGATGGTACCATACATTACTACTTCTTTGACTGATGCTAAACTTGGTGCGGAAGGACGCAAAGACCTTTTCGATTGGTTGTCCAGACAACTTACGGGAATAGCAGAGTTCCCTGATGCAATTCAATTGTTGAGACCTGTTGCTGCTGCTATGACGGATAAGTCAGTGGATGTTCGTAAAGCAGCAGAAACATTCTTTGGAGA...

Protein

Download Protein FASTA

1036 aa · TkA07G077520|TK1151|PROTEIN

MRESALAALDSWVAATHLDKMVPYITTSLTDAKLGAEGRKDLFDWLSRQLTGIAEFPDAIQLLRPVAAAMTDKSVDVRKAAETFFGDIVRVCGPEVVMKNSRDIQGPALAIVLERLKSHGAVPEVHDNAKTSAPSWQAAKTKVGKSNGYGSKAGSRAVSSRGVSAKAAKSEPIMSVQDINVQSQALLNIKDSNKDERERSVVRRFKFEEVRLEQIQDLENDLMKYFREDLHRRLLSTDFKKQVDGIEMLQRALPTMGKEI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G077520
TK1151 IDTkA07G077520
OH-1004 IDLXL04_027601
Relationship / confidenceSequence Supported Annotation Or Model Conflict / Review
Protein identity (%)97.600
Protein coverage (%)TK1151 100.000 / OH-1004 52.979
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G077520
LocationChr07:20169225-20181442 (-)
DescriptionSimilar to MOR1: Protein MOR1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g35630 Microtubule-binding protein that is essential for cortical microtubules organization and function.
MOR1 is essential for organizing cortical microtubules in plants.2001 · DOI: 10.1038/35079128
Mutation or drug-dependent microtubule disruption causes radial swelling without altering parallel cellulose microfibril deposition in Arabidopsis root cells.2003 · DOI: 10.1105/tpc.011593
Genetic analysis of adventitious root formation with a novel series of temperature-sensitive mutants of Arabidopsis thaliana.2003 · DOI: 10.1242/dev.00794
Cellulose microfibril alignment recovers from DCB-induced disruption despite microtubule disorganization.2003 · DOI: 10.1046/j.1365-313x.2003.01906.x
Aberrant cell plate formation in the Arabidopsis thaliana microtubule organization 1 mutant.2005 · DOI: 10.1093/pcp/pci068
MICROTUBULE ORGANIZATION 1 regulates structure and function of microtubule arrays during mitosis and cytokinesis in the Arabidopsis root.2006 · DOI: 10.1104/pp.105.069989
Hypersensitivity to cytoskeletal antagonists demonstrates microtubule-microfilament cross-talk in the control of root elongation in Arabidopsis thaliana.2006 · DOI: 10.1111/j.1469-8137.2006.01671.x
MOR1, the Arabidopsis thaliana homologue of Xenopus MAP215, promotes rapid growth and shrinkage, and suppresses the pausing of microtubules in vivo.2008 · DOI: 10.1242/jcs.039065

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0816400 Microtubule-associated protein that is essential for cortical microtubules organization and function. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_027601 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000226 microtubule cytoskeleton organization Biological Process
GO:0000911 cytokinesis by cell plate formation Biological Process
GO:0002181 cytoplasmic translation Biological Process
GO:0007019 microtubule depolymerization Biological Process
GO:0007051 spindle organization Biological Process
GO:0007052 mitotic spindle organization Biological Process
GO:0007098 centrosome cycle Biological Process
GO:0009920 cell plate formation involved in plant-type cell wall biogenesis Biological Process
GO:0010609 mRNA localization resulting in post-transcriptional regulation of gene expression Biological Process
GO:0022618 protein-RNA complex assembly Biological Process
GO:0030951 establishment or maintenance of microtubule cytoskeleton polarity Biological Process
GO:0045807 positive regulation of endocytosis Biological Process
KEGG gene cross-reference
ath:AT2G35630
dosa:Os01g0816400
hsa:9793
mmu:75786
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.691
Rank 1 · TkA07G077520 · TK1151
Cell membrane0.197
Rank 2 · TkA07G077520 · TK1151
Nucleus0.178
Rank 3 · TkA07G077520 · TK1151
Golgi apparatus0.148
Rank 4 · TkA07G077520 · TK1151
Lysosome / Vacuole0.059
Rank 5 · TkA07G077520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25782TPR_CAND115-127 aa
PF24987HEAT_EF3_N21-95 aa
PF08161RRP12_HEAT57-99 aa
PF24492HEAT_ECM2959-104 aa
PF21041XMAP215_CLASP_TOG60-99 aa
PF02985HEAT62-92 aa
PF26611MAD7171-226 aa
PF11698V-ATPase_H_C173-189 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G077520PF25782TPR_CAND1151270.008617.2
TkA07G077520PF24987HEAT_EF3_N21951.4e-0525.8
TkA07G077520PF08161RRP12_HEAT57990.007216.5
TkA07G077520PF24492HEAT_ECM29591040.1812.7
TkA07G077520PF21041XMAP215_CLASP_TOG60994.9e-0833.7
TkA07G077520PF02985HEAT62920.04514.7
TkA07G077520PF26611MAD71712260.0313.8
TkA07G077520PF11698V-ATPase_H_C1731890.0009320.1
TkA07G077520PF28950YDR249C_C2593071.59.3
TkA07G077520PF21041XMAP215_CLASP_TOG2734414.9e-0833.7
TkA07G077520PF24987HEAT_EF3_N3123811.4e-0525.8
TkA07G077520PF11698V-ATPase_H_C3234110.0009320.1
TkA07G077520PF25782TPR_CAND13273890.008617.2
TkA07G077520PF24492HEAT_ECM293434210.1812.7
TkA07G077520PF02985HEAT3483750.04514.7
TkA07G077520PF02985HEAT4004110.04514.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q94FN2Arabidopsis thalianasp|Q94FN2|MOR1_ARATH Protein MOR170.200%Swiss-ProtHigh
Q5N749Oryza sativa subsp. japonicasp|Q5N749|MOR1_ORYSJ Protein MOR166.200%Swiss-ProtHigh

JBrowse

View in Genome Browser