RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G076920
Reference: TK1151 Chr: Chr07 Coordinates: 20015621-20017898 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1932 bp · TkA07G076920|TK1151|cDNA

CATTAATCTCCGGTCCATAAAACTCAAAAAAAGTAAACCATAAAATCGCCACCTCCACACCCCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTGCAAGTAATTTATCCCTCCGCCGTACGTCGTCGTCATAAATATCGCCAACAACCCTTCTTCCCATCTTCACCGGCCTCCTCCTCCGTTCTGTACGAAAACTCTATATTTTCATTTATTGGCGGAGTAGTAGCCAGAAATCCATACCCAACGTCCACTGTCCTTTTGTT...

CDS

Download CDS FASTA

1398 bp · TkA07G076920|TK1151|CDS

ATGTTAGAGTTTCCGAGGGATCAGTCAGAAGGTTCAGGAGAAGAAGCGGTTTCTGAAGCGGTGAATTCAAGTCAAAGCTCGATGAGTAGTGATAGTTGTACTAGCTTTAGTCGTTTGTCATTTGATGCGTTAGAGCTGCTTCCACCTACTCGGCCACTGTACTCGCCGGAGAATATGATAATGAAGCCGCATAGGTCTTCCGAGTCGTCGTGGCAAGCTATTCGTACGGTGGCGTTGAAGAGGAGCAGCAGTGAAGGATT...

Protein

Download Protein FASTA

465 aa · TkA07G076920|TK1151|PROTEIN

MLEFPRDQSEGSGEEAVSEAVNSSQSSMSSDSCTSFSRLSFDALELLPPTRPLYSPENMIMKPHRSSESSWQAIRTVALKRSSSEGFGGVDGGSSLSFRDFSLVRQIGSGDIGKVYLCRLRNEDVEESRCYYAMKVVDREVLALKKKIQRAATERKILNMLDHPFLPSLYAQFEASHFSCVVMEYCSGGDLHSLRHKQPRKRFSLSAARFYAAEVLVALEYLHMLGIIYRDLKPENVLVRSDGHIMLTDFDLSLCSDAIP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G076920
TK1151 IDTkA07G076920
OH-1004 IDLXL04_027595
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.800
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G076920
LocationChr07:20015621-20017898 (+)
DescriptionSimilar to PID: Protein kinase PINOID
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g34650 Serine/threonine-protein kinase involved in the regulation of auxin signaling. No verified direct reference in this release
At5g55910 Protein kinase that regulates the auxin transport activity of PIN auxin efflux facilitators by direct phosphorylation.
The polarly localized D6 PROTEIN KINASE is required for efficient auxin transport in Arabidopsis thaliana.2009 · DOI: 10.1242/dev.028365
D6PK AGCVIII kinases are required for auxin transport and phototropic hypocotyl bending in Arabidopsis.2013 · DOI: 10.1105/tpc.113.111484
Arabidopsis D6PK is a lipid domain-dependent mediator of root epidermal planar polarity.2015 · DOI: 10.1038/nplants.2015.162
At3g12690 Functions redundantly with AGC1-7 as signaling component in the pollen tube.
Two Arabidopsis AGC kinases are critical for the polarized growth of pollen tubes.2009 · DOI: 10.1111/j.1365-313x.2009.03792.x

Rice

Reference gene IDPossible functionPapers / DOI
Os12g0614600 Serine/threonine-protein kinase involved in the regulation of auxin signaling. No verified direct reference in this release
Os01g0174700 Serine/threonine-protein kinase involved in the regulation of auxin signaling. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_027595 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006468 protein phosphorylation Biological Process
GO:0009630 gravitropism Biological Process
GO:0009638 phototropism Biological Process
GO:0009733 response to auxin Biological Process
GO:0009734 auxin-activated signaling pathway Biological Process
GO:0009908 flower development Biological Process
GO:0009926 auxin polar transport Biological Process
GO:0009958 positive gravitropism Biological Process
GO:0010540 basipetal auxin transport Biological Process
GO:0048364 root development Biological Process
GO:0048367 shoot system development Biological Process
GO:0048766 root hair initiation Biological Process
KEGG gene cross-reference
ath:AT2G34650
ath:AT4G26610
ath:AT5G47750
ath:AT5G55910
dosa:Os12g0614600
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.606
Rank 1 · TkA07G076920 · TK1151
Nucleus0.427
Rank 2 · TkA07G076920 · TK1151
Cell membrane0.071
Rank 3 · TkA07G076920 · TK1151
Mitochondrion0.051
Rank 4 · TkA07G076920 · TK1151
Golgi apparatus0.035
Rank 5 · TkA07G076920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase102-253 aa
PF07714PK_Tyr_Ser-Thr103-254 aa
PF01636APH144-210 aa
PF03109ABC1174-250 aa
PF14531Kinase-like206-251 aa
PF01636APH224-258 aa
PF00069Pkinase320-426 aa
PF07714PK_Tyr_Ser-Thr327-410 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G076920PF00069Pkinase1022532.4e-57195.0
TkA07G076920PF07714PK_Tyr_Ser-Thr1032543.5e-2899.3
TkA07G076920PF01636APH1442100.08313.4
TkA07G076920PF03109ABC11742500.01115.6
TkA07G076920PF14531Kinase-like2062510.0007419.6
TkA07G076920PF01636APH2242580.08313.4
TkA07G076920PF00069Pkinase3204262.4e-57195.0
TkA07G076920PF07714PK_Tyr_Ser-Thr3274103.5e-2899.3
TkA07G076920PF14531Kinase-like3433740.0007419.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
O64682Arabidopsis thalianasp|O64682|PID_ARATH Protein kinase PINOID61.800%Swiss-ProtHigh
Q9FG74Arabidopsis thalianasp|Q9FG74|D6PK_ARATH Serine/threonine-protein kinase D6PK50.100%Swiss-ProtHigh
Q9LTW5Arabidopsis thalianasp|Q9LTW5|AGC15_ARATH Serine/threonine-protein kinase AGC1-550.100%Swiss-ProtHigh
Q2QM77Oryza sativa subsp. japonicasp|Q2QM77|PID_ORYSJ Protein kinase PINOID53.100%Swiss-ProtHigh
Q94E49Oryza sativa subsp. japonicasp|Q94E49|PID2_ORYSJ Protein kinase PINOID 247.100%Swiss-ProtMedium

JBrowse

View in Genome Browser