LXL04_027595 | RubberDandelionOmics

Gene overview

LXL04_027595

Reference: OH-1004 Chr: Chr06 Coordinates: 19837687-19839430 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1398 bp · LXL04_027595|LXL04_027595|OH1004|cDNA

ATGTTAGAGTTTCCGAGGGATCAGTCAGAAGGTTCAGGAGAAGAAGCGGTTTCTGAAGCGGTGAATTCAAGTCAAAGCTCGATGAGTAGTGATAGTTGTACTAGCTTTAGTCGTTTGTCATTTGATGCGTTAGAGCTGCTTCCACCTACTCGGCCACTGTACTCGCCGGAGAATATGATAATGAAGCCGCATAGGTCTTCCGAGTCGTCGTGGCAAGCTATTCGTACGGTGGCGTTGAAGAGGAGCAGCAGTGAAGGATT...

CDS

Download CDS FASTA

1398 bp · LXL04_027595|LXL04_027595|OH1004|CDS

ATGTTAGAGTTTCCGAGGGATCAGTCAGAAGGTTCAGGAGAAGAAGCGGTTTCTGAAGCGGTGAATTCAAGTCAAAGCTCGATGAGTAGTGATAGTTGTACTAGCTTTAGTCGTTTGTCATTTGATGCGTTAGAGCTGCTTCCACCTACTCGGCCACTGTACTCGCCGGAGAATATGATAATGAAGCCGCATAGGTCTTCCGAGTCGTCGTGGCAAGCTATTCGTACGGTGGCGTTGAAGAGGAGCAGCAGTGAAGGATT...

Protein

Download Protein FASTA

465 aa · LXL04_027595|LXL04_027595|OH1004|PROTEIN

MLEFPRDQSEGSGEEAVSEAVNSSQSSMSSDSCTSFSRLSFDALELLPPTRPLYSPENMIMKPHRSSESSWQAIRTVALKRSSSEGFGGVDGGSSLSFRDFSLVRQIGSGDIGKVYLCRLRNEDVEESRCYYAMKVVDREVLALKKKIQRAATERKILNMLDHPFLPSLYAQFEASHFSCVVMEYCSGGDLHSLRHKQPRKRFSLSAARFYAAEVLVALEYLHMLGIIYRDLKPENVLVRSDGHIMLTDFDLSLCSDAIP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027595`
TK1151 ID	TkA07G076920
OH-1004 ID	LXL04_027595
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027595

Location Chr06:19837687-19839430 (+)

Description Similar to PID: Protein kinase PINOID

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g34650`	Serine/threonine-protein kinase involved in the regulation of auxin signaling.	No verified direct reference in this release
`At5g47750`	Protein kinase that regulates the auxin transport activity of PIN auxin efflux facilitators by direct phosphorylation.	D6PK AGCVIII kinases are required for auxin transport and phototropic hypocotyl bending in Arabidopsis.2013 · DOI: 10.1105/tpc.113.111484
`At5g55910`	Protein kinase that regulates the auxin transport activity of PIN auxin efflux facilitators by direct phosphorylation.	The polarly localized D6 PROTEIN KINASE is required for efficient auxin transport in Arabidopsis thaliana.2009 · DOI: 10.1242/dev.028365 D6PK AGCVIII kinases are required for auxin transport and phototropic hypocotyl bending in Arabidopsis.2013 · DOI: 10.1105/tpc.113.111484 Arabidopsis D6PK is a lipid domain-dependent mediator of root epidermal planar polarity.2015 · DOI: 10.1038/nplants.2015.162
`At4g26610`	Protein kinase that regulates the auxin transport activity of PIN auxin efflux facilitators by direct phosphorylation.	D6PK AGCVIII kinases are required for auxin transport and phototropic hypocotyl bending in Arabidopsis.2013 · DOI: 10.1105/tpc.113.111484

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0614600`	Serine/threonine-protein kinase involved in the regulation of auxin signaling.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027595 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0009630 gravitropism Biological Process

GO:0009638 phototropism Biological Process

GO:0009733 response to auxin Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009908 flower development Biological Process

GO:0009926 auxin polar transport Biological Process

GO:0009958 positive gravitropism Biological Process

GO:0010540 basipetal auxin transport Biological Process

GO:0048364 root development Biological Process

GO:0048367 shoot system development Biological Process

GO:0048766 root hair initiation Biological Process

KEGG gene cross-reference

ath:AT2G34650

ath:AT4G26610

ath:AT5G47750

ath:AT5G55910

dosa:Os12g0614600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.608

Rank 1 · LXL04_027595 · OH-1004

Nucleus0.428

Rank 2 · LXL04_027595 · OH-1004

Cell membrane0.070

Rank 3 · LXL04_027595 · OH-1004

Mitochondrion0.051

Rank 4 · LXL04_027595 · OH-1004

Endoplasmic reticulum0.035

Rank 5 · LXL04_027595 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase102-253 aa

PF07714.24PK_Tyr_Ser-Thr103-254 aa

PF00069.32Pkinase320-426 aa

PF07714.24PK_Tyr_Ser-Thr327-410 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027595	`PF00069.32`	Pkinase	102	253	2.4e-57	195.0
LXL04_027595	`PF07714.24`	PK_Tyr_Ser-Thr	103	254	3.5e-28	99.3
LXL04_027595	`PF00069.32`	Pkinase	320	426	2.4e-57	195.0
LXL04_027595	`PF07714.24`	PK_Tyr_Ser-Thr	327	410	3.5e-28	99.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64682`	Arabidopsis thaliana	Protein kinase PINOID	60.606%	Swiss-Prot	strong database homology
`Q39183`	Arabidopsis thaliana	Serine/threonine-protein kinase D6PKL2	50.990%	Swiss-Prot	strong database homology
`Q9FG74`	Arabidopsis thaliana	Serine/threonine-protein kinase D6PK	51.111%	Swiss-Prot	strong database homology
`Q9SUA3`	Arabidopsis thaliana	Serine/threonine-protein kinase D6PKL1	51.378%	Swiss-Prot	strong database homology
`Q2QM77`	Oryza sativa subsp. japonica	Protein kinase PINOID	54.953%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card