TkA07G039520 | RubberDandelionOmics

Gene overview

TkA07G039520

Reference: TK1151 Chr: Chr07 Coordinates: 10476027-10479987 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1830 bp · TkA07G039520|TK1151|cDNA

CTACAAAACTAGCTGGACGTTCCCTCTAATAAACCGAGATAGCTTTGTTTTATCAGTCGAACCAACCCACACACAATTCGTCGTCGTGACCGTCGGCTAGTCCGGCGACTGAGACTGCCGCCGCAGTTACTCATCAATTTGCTACAATCGTTGTATCTAAAACTGTAAGCAGCAGAAATTGTGTCGTTCGTAGTTCGTGGTTGTCAATATCCAAACTAGTTTCAATTCGAAGGTAAGAAACAACCCTACCAACAAAATCG...

CDS

Download CDS FASTA

1161 bp · TkA07G039520|TK1151|CDS

ATGATGAATTCTATAAGGAAGCTAGTTTCATGTGTGATCCTAGACTTGGATGGAACACTTGTAAATACAGATGGCATAGTGAGTGAAGTTCTGAAAGTTTACTTGGTTAAATATGAGAAGAAATGGGATGGTAGAGAGGCTCATAAGATCATAGGGAAAACTCCAATAGAAGCTGCAGCTGCTATTGTGGAGGATTATGAGCTCCCTTTATCTAAAGAAGACTTGCTATCAGAAATTTCCCCAATGTTCTCTGATCAATG...

Protein

Download Protein FASTA

386 aa · TkA07G039520|TK1151|PROTEIN

MMNSIRKLVSCVILDLDGTLVNTDGIVSEVLKVYLVKYEKKWDGREAHKIIGKTPIEAAAAIVEDYELPLSKEDLLSEISPMFSDQWCKLKALPGAYRLVKHLRGHGVKMALASNSPLASIETKISYHNNWKESFAAIVAGDEVKAGKPSPEIFLEASKRLNIDPSKCLVIEDSLPGIAAAKAAKMEVVAVPSLPKQSHLYTDADEVINSLFDLHPEKWGLPPFEDWINGTLPLEPWYIGGPVIKGYGRGSKVLGIPTAN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G039520`
TK1151 ID	TkA07G039520
OH-1004 ID	LXL04_027191
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G039520

Location Chr07:10476027-10479987 (-)

Description Similar to FHY: Bifunctional riboflavin kinase/FMN phosphatase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g21470`	Bifunctional enzyme that catalyzes the hydrolysis of flavin-mononucleotide (FMN) to riboflavin (vitamin B2) and the phosphorylation of riboflavin to form (FMN) coenzyme.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027191 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006114 glycerol biosynthetic process Biological Process

GO:0006771 riboflavin metabolic process Biological Process

GO:0009117 nucleotide metabolic process Biological Process

GO:0009231 riboflavin biosynthetic process Biological Process

GO:0009398 FMN biosynthetic process Biological Process

GO:0016311 dephosphorylation Biological Process

GO:0033864 positive regulation of NAD(P)H oxidase activity Biological Process

GO:0072593 reactive oxygen species metabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT4G21470

ath:AT5G57440

hsa:55312

hsa:8226

mmu:54391

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.613

Rank 1 · TkA07G039520 · TK1151

Nucleus0.261

Rank 2 · TkA07G039520 · TK1151

Mitochondrion0.158

Rank 3 · TkA07G039520 · TK1151

Peroxisome0.085

Rank 4 · TkA07G039520 · TK1151

Cell membrane0.074

Rank 5 · TkA07G039520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00702Hydrolase10-184 aa

PF13419HAD_212-191 aa

PF12710HAD12-151 aa

PF13344Hydrolase_612-30 aa

PF13344Hydrolase_690-120 aa

PF13242Hydrolase_like146-193 aa

PF01687Flavokinase236-360 aa

PF00702Hydrolase306-353 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G039520	`PF00702`	Hydrolase	10	184	6.4e-26	92.7
TkA07G039520	`PF13419`	HAD_2	12	191	1.6e-26	94.1
TkA07G039520	`PF12710`	HAD	12	151	0.00014	23.1
TkA07G039520	`PF13344`	Hydrolase_6	12	30	0.0047	17.7
TkA07G039520	`PF13344`	Hydrolase_6	90	120	0.0047	17.7
TkA07G039520	`PF13242`	Hydrolase_like	146	193	5.2e-06	27.0
TkA07G039520	`PF01687`	Flavokinase	236	360	1.2e-35	123.1
TkA07G039520	`PF00702`	Hydrolase	306	353	6.4e-26	92.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84MD8`	Arabidopsis thaliana	sp\|Q84MD8\|FHYRK_ARATH Bifunctional riboflavin kinase/FMN phosphatase	68.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card