LXL04_027191 | RubberDandelionOmics

Gene overview

LXL04_027191

Reference: OH-1004 Chr: Chr06 Coordinates: 10742087-10744294 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1237 bp · LXL04_027191|LXL04_027191|OH1004|cDNA

CATCTATTGGTATTGCAGAAGTTTGTAAATGCAAGCCTAAAATCTTCTGAAAGAGTTCTGATTCTACCAAAACTGGATGATGAATTCTATAAGGAAGCTAGTTTCATGTGTGATCCTAGACTTGGATGGAACACTTGTAAATACAGATGGCATAGTGAGTGAAGTTCTGAAAGTTTACTTGGTTAAATATGAGAAGAAATGGGATGGTAGAGAGGCTCATAAGATCATAGGGAAAACTCCAATAGAAGCTGCAGCTGCTA...

CDS

Download CDS FASTA

1161 bp · LXL04_027191|LXL04_027191|OH1004|CDS

ATGATGAATTCTATAAGGAAGCTAGTTTCATGTGTGATCCTAGACTTGGATGGAACACTTGTAAATACAGATGGCATAGTGAGTGAAGTTCTGAAAGTTTACTTGGTTAAATATGAGAAGAAATGGGATGGTAGAGAGGCTCATAAGATCATAGGGAAAACTCCAATAGAAGCTGCAGCTGCTATTGTGGAGGATTATGAGCTCCCTTTATCTAAAGAAGACTTGCTATCAGAAATTTCCCCAATGTTCTCTGATCAATG...

Protein

Download Protein FASTA

386 aa · LXL04_027191|LXL04_027191|OH1004|PROTEIN

MMNSIRKLVSCVILDLDGTLVNTDGIVSEVLKVYLVKYEKKWDGREAHKIIGKTPIEAAAAIVEDYELPLSKEDLLSEISPMFSDQWCKLKALPGAYRLVKHLRGHGVKMALASNSPLASIETKISYHNNWKESFAAIVAGDEVKAGKPSPEIFLEASKRLNIDPSKCLVIEDSLPGIAAAKAAKMEVVAVPSLPKQSHLYTDADEVINSLFDLRPEKWGLPPFEDWINGTLPLEPWYIGGPVIKGYGRGSKVLGIPTAN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027191`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027191

Location Chr06:10742087-10744294 (-)

Description Similar to FHY: Bifunctional riboflavin kinase/FMN phosphatase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g21470`	Bifunctional enzyme that catalyzes the hydrolysis of flavin-mononucleotide (FMN) to riboflavin (vitamin B2) and the phosphorylation of riboflavin to form (FMN) coenzyme.	No verified direct reference in this release
`At5g57440`	Acts as a glycerol-3-phosphatase with higher stereospecificity for L-glycerol-3-phosphate than DL-glycerol-3- phosphate.	Arabidopsis thaliana AtGppl and AtGpp2: two novel low molecular weight phosphatases involved in plant glycerol metabolism.2007 · DOI: 10.1007/s11103-006-9104-0

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027191 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006114 glycerol biosynthetic process Biological Process

GO:0006771 riboflavin metabolic process Biological Process

GO:0009117 nucleotide metabolic process Biological Process

GO:0009231 riboflavin biosynthetic process Biological Process

GO:0009398 FMN biosynthetic process Biological Process

GO:0016311 dephosphorylation Biological Process

GO:0033864 positive regulation of NAD(P)H oxidase activity Biological Process

GO:0072593 reactive oxygen species metabolic process Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT4G21470

ath:AT5G57440

hsa:55312

hsa:8226

mmu:54391

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.620

Rank 1 · LXL04_027191 · OH-1004

Nucleus0.263

Rank 2 · LXL04_027191 · OH-1004

Mitochondrion0.149

Rank 3 · LXL04_027191 · OH-1004

Peroxisome0.084

Rank 4 · LXL04_027191 · OH-1004

Cell membrane0.076

Rank 5 · LXL04_027191 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00702.33Hydrolase10-184 aa

PF13419.13HAD_212-191 aa

PF13242.13Hydrolase_like146-193 aa

PF01687.24Flavokinase236-360 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027191	`PF00702.33`	Hydrolase	10	184	5.9e-26	92.8
LXL04_027191	`PF13419.13`	HAD_2	12	191	1.6e-26	94.1
LXL04_027191	`PF13242.13`	Hydrolase_like	146	193	5.2e-06	27.0
LXL04_027191	`PF01687.24`	Flavokinase	236	360	1.4e-35	122.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84MD8`	Arabidopsis thaliana	Bifunctional riboflavin kinase/FMN phosphatase	68.533%	Swiss-Prot	strong database homology
`Q8VZP1`	Arabidopsis thaliana	(DL)-glycerol-3-phosphatase 2	38.865%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card