RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G034940
Reference: TK1151 Chr: Chr07 Coordinates: 9317990-9321126 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2297 bp · TkA07G034940|TK1151|cDNA

GACATAGTTAACTTTCATTTATAACAACCAATATTTTTCAAAGATTCTGTGAAAGTGGAAATGAAATCCATAGCATCGTTGCTGTTTTTTCTCCAGATAGTCATCAATGGTGTTCTTCTCAGGACAGCTCAATCTGCAGAATATGGCATCTACAAGTGCAGAAACACTGGCAATTTCACAAGCACCACATACCTAAAAGCCCTCGAAACCGCACTCGATTCGCTTCCCGGAAACGTCACAAACAACCGCGAATTCGTAAA...

CDS

Download CDS FASTA

2013 bp · TkA07G034940|TK1151|CDS

ATGAAATCCATAGCATCGTTGCTGTTTTTTCTCCAGATAGTCATCAATGGTGTTCTTCTCAGGACAGCTCAATCTGCAGAATATGGCATCTACAAGTGCAGAAACACTGGCAATTTCACAAGCACCACATACCTAAAAGCCCTCGAAACCGCACTCGATTCGCTTCCCGGAAACGTCACAAACAACCGCGAATTCGTAAATTCGACTGCCGGCGAAAACACAGGTACTCAGGTAAATGCCGTCGCGTTGTGCCGCGGCTA...

Protein

Download Protein FASTA

670 aa · TkA07G034940|TK1151|PROTEIN

MKSIASLLFFLQIVINGVLLRTAQSAEYGIYKCRNTGNFTSTTYLKALETALDSLPGNVTNNREFVNSTAGENTGTQVNAVALCRGYIGWEACRTCVKNSIPLLRRECPNQKEAAAWYSDCMVRYSDRKILGVLDSWTSDNESTTARVANFDEFDTAFRNLTTRLQAEAAGGNSFLKLAVGDVTYGTDSLMIYAMMQCTPDLSKEQCSKCLNSTIVGIHDCCSGKVAGRVFFPNCFLRYANDKFYNDAISTPSPSPSGKN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G034940
TK1151 IDTkA07G034940
OH-1004 IDLXL04_027139
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)100.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G034940
LocationChr07:9317990-9321126 (-)
DescriptionSimilar to CRK10: Cysteine-rich receptor-like protein kinase 10
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g23180 Cysteine-rich receptor-like protein kinase 10. No verified direct reference in this release
At4g23280 Putative cysteine-rich receptor-like protein kinase 20. No verified direct reference in this release
At4g23270 Cysteine-rich receptor-like protein kinase 19. No verified direct reference in this release
At4g11530 Cysteine-rich receptor-like protein kinase 34. No verified direct reference in this release
At4g23140 Cysteine-rich receptor-like protein kinase 6. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_027139 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006952 defense response Biological Process
GO:0006979 response to oxidative stress Biological Process
GO:0007165 signal transduction Biological Process
GO:0009626 plant-type hypersensitive response Biological Process
GO:0009751 response to salicylic acid Biological Process
GO:0012501 programmed cell death Biological Process
GO:0042742 defense response to bacterium Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005634 nucleus Cellular Component
GO:0005829 cytosol Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0009507 chloroplast Cellular Component
KEGG gene cross-reference
ath:AT4G05200
ath:AT4G23180
ath:AT4G23190
ath:AT4G23270
ath:AT4G23280
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.895
Rank 1 · TkA07G034940 · TK1151
Endoplasmic reticulum0.071
Rank 2 · TkA07G034940 · TK1151
Cytoplasm0.068
Rank 3 · TkA07G034940 · TK1151
Nucleus0.037
Rank 4 · TkA07G034940 · TK1151
Lysosome / Vacuole0.022
Rank 5 · TkA07G034940 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01657Stress-antifung32-127 aa
PF01657Stress-antifung149-241 aa
PF14610Psg1258-297 aa
PF103237TM_GPCR_Srv261-304 aa
PF27898C3orf18_N267-300 aa
PF06667PspB269-313 aa
PF00069Pkinase351-618 aa
PF07714PK_Tyr_Ser-Thr352-619 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G034940PF01657Stress-antifung321274.8e-34117.7
TkA07G034940PF01657Stress-antifung1492414.8e-34117.7
TkA07G034940PF14610Psg12582970.07713.5
TkA07G034940PF103237TM_GPCR_Srv2613040.07713.1
TkA07G034940PF27898C3orf18_N2673000.08313.6
TkA07G034940PF06667PspB2693130.2412.2
TkA07G034940PF00069Pkinase3516188.4e-47160.5
TkA07G034940PF07714PK_Tyr_Ser-Thr3526192.3e-48165.5
TkA07G034940PF03109ABC13553819.8e-0625.6
TkA07G034940PF03109ABC14154999.8e-0625.6
TkA07G034940PF12330Haspin_kinase4454980.0214.7
TkA07G034940PF01636APH4644960.1612.4
TkA07G034940PF17667Pkinase_fungal4695370.02114.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8GYA4Arabidopsis thalianasp|Q8GYA4|CRK10_ARATH Cysteine-rich receptor-like protein kinase 1046.100%Swiss-ProtMedium
O65479Arabidopsis thalianasp|O65479|CRK20_ARATH Putative cysteine-rich receptor-like protein kinase 2044.700%Swiss-ProtMedium
Q8GWJ7Arabidopsis thalianasp|Q8GWJ7|CRK19_ARATH Cysteine-rich receptor-like protein kinase 1944.200%Swiss-ProtMedium
Q9LDQ3Arabidopsis thalianasp|Q9LDQ3|CRK34_ARATH Cysteine-rich receptor-like protein kinase 3446.200%Swiss-ProtMedium
Q9C5S9Arabidopsis thalianasp|Q9C5S9|CRK6_ARATH Cysteine-rich receptor-like protein kinase 648.200%Swiss-ProtMedium

JBrowse

View in Genome Browser