TkA07G026710 | RubberDandelionOmics

Gene overview

TkA07G026710

Reference: TK1151 Chr: Chr07 Coordinates: 7198038-7201563 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2186 bp · TkA07G026710|TK1151|cDNA

TTTTGGTCCATCAATGGGATGATGAAGCCCACACTAAAGATCTTCAAGTCTAGAAATGGCAATTACTCACTTGCTTTCTTGCATGCCAATATGCCATGCCATTGTTGTTCTTGAGCTGCAAGTCTGCAACAAGTAACTTCGTATGATTAATGATTTACCCCCTCAAAACCTCTGATCACTCACGGAATCGAGGAAAATCGCCACGTTTTCATGGCGTCAGTTCGTCGCCTTGCTCGGACAATTCAGACTTGCCGTACGAT...

CDS

Download CDS FASTA

1722 bp · TkA07G026710|TK1151|CDS

ATGGCGTCAGTTCGTCGCCTTGCTCGGACAATTCAGACTTGCCGTACGATCGCATTTCGTAAAACCCTAACCCCGTCGTTTCAACCTCCGCGCCACTTCTCCCACCGTACTTTCAAGCAGGACAGCTACTCCCACCATGGTAGATCTTCGAGGTCAAAAAATGCTTTTGGATTTGATTATCATCCTGCAATTCTAGCTGGGATATTCGGATTTAGCGTAACAAACATAGCCTATGCGGATGCACCTGAGTCTAAACCACC...

Protein

Download Protein FASTA

573 aa · TkA07G026710|TK1151|PROTEIN

MASVRRLARTIQTCRTIAFRKTLTPSFQPPRHFSHRTFKQDSYSHHGRSSRSKNAFGFDYHPAILAGIFGFSVTNIAYADAPESKPPLPPEPPSSHINMEAIAKKERTRLEELLKTKGMPYGSYPRFTVAVKGKKITIKFQIPPTCEISLLISNIVANLGVKVEERATGSDMNLRAWDSGVAWQLTLTRPNPNPNDGDLCILMFRSLISSDKPEMEFIKEGGFTNEELDALVSVLKLAGVGPTRGMDRRGDSSTRNPSTM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G026710`
TK1151 ID	TkA07G026710
OH-1004 ID	LXL04_027031
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G026710`
Location	Chr07:7198038-7201563 (+)
Description	Similar to MJ1156: Cell division cycle protein 48 homolog MJ1156 (Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_027031` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0010498 proteasomal protein catabolic process Biological Process GO:0043335 protein unfolding Biological Process GO:0005737 cytoplasm Cellular Component GO:0022623 proteasome-activating nucleotidase complex Cellular Component GO:0005524 ATP binding Molecular Function GO:0016887 ATP hydrolysis activity Molecular Function
KEGG gene cross-reference	mja:MJ_1156 mka:MK0878 mmp:MMP1647 mmz:MmarC7_0920 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.925

Rank 1 · TkA07G026710 · TK1151

Cytoplasm0.086

Rank 2 · TkA07G026710 · TK1151

Nucleus0.069

Rank 3 · TkA07G026710 · TK1151

Cell membrane0.033

Rank 4 · TkA07G026710 · TK1151

Plastid0.033

Rank 5 · TkA07G026710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13401AAA_22134-173 aa

PF05673DUF815319-447 aa

PF06414Zeta_toxin323-358 aa

PF13191AAA_16331-440 aa

PF13086AAA_11333-359 aa

PF20720nSTAND3334-361 aa

PF00158Sigma54_activat334-410 aa

PF12775AAA_7334-359 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G026710	`PF13401`	AAA_22	134	173	0.0011	20.0
TkA07G026710	`PF05673`	DUF815	319	447	0.00035	20.5
TkA07G026710	`PF06414`	Zeta_toxin	323	358	0.11	12.6
TkA07G026710	`PF13191`	AAA_16	331	440	0.00053	21.3
TkA07G026710	`PF13086`	AAA_11	333	359	0.049	14.1
TkA07G026710	`PF20720`	nSTAND3	334	361	0.019	15.4
TkA07G026710	`PF00158`	Sigma54_activat	334	410	0.093	13.1
TkA07G026710	`PF12775`	AAA_7	334	359	0.28	11.4
TkA07G026710	`PF06745`	ATPase	335	441	0.19	11.8
TkA07G026710	`PF13401`	AAA_22	336	369	0.0011	20.0
TkA07G026710	`PF13173`	AAA_14	336	409	0.0019	18.9
TkA07G026710	`PF14532`	Sigma54_activ_2	336	409	0.091	13.8
TkA07G026710	`PF05729`	NACHT	336	359	0.12	12.9
TkA07G026710	`PF06068`	TIP49	336	368	0.14	12.0
TkA07G026710	`PF05496`	RuvB_N	337	460	3e-05	24.5
TkA07G026710	`PF00004`	AAA	338	466	3.8e-37	128.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card