TkA07G006560 | RubberDandelionOmics

Gene overview

TkA07G006560

Reference: TK1151 Chr: Chr07 Coordinates: 1817557-1822939 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1291 bp · TkA07G006560|TK1151|cDNA

AATTAACAGTTAACACTTGGTTGGAAGTTGGGACGGGTTGATAACTGTTCTTATTTCTCACACTTTCCTTCAATCCGACCAAGTTTCCAGCCGAACACGATGACTCTTCTGCTACAAAATCTCCCGCCGGTACCTTCATCGACTCCTCCCCTTCACTACACAAGATCCCACTCACTTGTGTGTGGTGTATCAAGTAGTAACACCGATAAACCTAGAATCAAACCCAAAATAACCAGAATCAAAATTAAAGAACCCGACGA...

CDS

Download CDS FASTA

1020 bp · TkA07G006560|TK1151|CDS

ATGACTCTTCTGCTACAAAATCTCCCGCCGGTACCTTCATCGACTCCTCCCCTTCACTACACAAGATCCCACTCACTTGTGTGTGGTGTATCAAGTAGTAACACCGATAAACCTAGAATCAAACCCAAAATAACCAGAATCAAAATTAAAGAACCCGACGACTACCACGCAACTCTCAAAGCTCTCAATTCCAAAGGCCGCTTGCCTCGGAAAGCCCTTGGCCAGCATTACATGGTAAACAATGAAGTAAATGAACAGCT...

Protein

Download Protein FASTA

339 aa · TkA07G006560|TK1151|PROTEIN

MTLLLQNLPPVPSSTPPLHYTRSHSLVCGVSSSNTDKPRIKPKITRIKIKEPDDYHATLKALNSKGRLPRKALGQHYMVNNEVNEQLVNAANVGDGDMVLEIGPGTGSLTNVLVESGATILAIEKDPYMAALVRDRFASTHRVKVIPEDFTRCHLRSHLSSFMETDSSNSNSYAKVVANIPFNISSDVVKQLLPMGDIFSEVVLLLQEEAALRMVDASLRTSEYRPINIFINFYSDPEYKFKVPRENFFPQPKVDAAVVV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G006560`
TK1151 ID	TkA07G006560
OH-1004 ID	LXL04_026767
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G006560

Location Chr07:1817557-1822939 (-)

Description Similar to PFC1: Ribosomal RNA small subunit methyltransferase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g01860`	Required for methylation of the 3' adenosines in the small subunit of plastid rRNA.	Chloroplast development at low temperatures requires a homolog of DIM1, a yeast gene encoding the 18S rRNA dimethylase.1998 · DOI: 10.1105/tpc.10.5.699

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026767 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009409 response to cold Biological Process

GO:0031167 rRNA methylation Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0000179 rRNA (adenine-N6,N6-)-dimethyltransferase activity Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0016422 mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity Molecular Function

GO:0052908 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase activity Molecular Function

KEGG gene cross-reference

ana:alr3229

ath:AT1G01860

cmu:TC_0633

mta:Moth_0052

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.664

Rank 1 · TkA07G006560 · TK1151

Mitochondrion0.346

Rank 2 · TkA07G006560 · TK1151

Nucleus0.038

Rank 3 · TkA07G006560 · TK1151

Cytoplasm0.027

Rank 4 · TkA07G006560 · TK1151

Cell membrane0.007

Rank 5 · TkA07G006560 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00398RrnaAD70-335 aa

PF01728FtsJ91-186 aa

PF01135PCMT93-141 aa

PF13489Methyltransf_2395-141 aa

PF13649Methyltransf_2599-155 aa

PF08241Methyltransf_11100-156 aa

PF08242Methyltransf_12100-155 aa

PF01135PCMT243-255 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G006560	`PF00398`	RrnaAD	70	335	5.5e-44	151.0
TkA07G006560	`PF01728`	FtsJ	91	186	0.21	12.2
TkA07G006560	`PF01135`	PCMT	93	141	0.25	11.8
TkA07G006560	`PF13489`	Methyltransf_23	95	141	0.0077	16.7
TkA07G006560	`PF13649`	Methyltransf_25	99	155	7e-05	24.2
TkA07G006560	`PF08241`	Methyltransf_11	100	156	0.00028	22.2
TkA07G006560	`PF08242`	Methyltransf_12	100	155	0.0017	19.8
TkA07G006560	`PF01135`	PCMT	243	255	0.25	11.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65090`	Arabidopsis thaliana	sp\|O65090\|DIM1C_ARATH Ribosomal RNA small subunit methyltransferase, chloroplastic	71.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card