TkA06G471100 | RubberDandelionOmics

Gene overview

TkA06G471100

Reference: TK1151 Chr: Chr06 Coordinates: 116516977-116520713 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

804 bp · TkA06G471100|TK1151|cDNA

ATGGGAGTAATCGATTTGATAACGAGAGTAGATGCGATATGCACAAAGTACGAGAAGTACGACGTAGACAAGCAAAAGGACGCCGCCAACAATATCAATCGGAACGATGCATTTGCCGGACTTTACACCGCCATCGAATCCGATCTGAATCAAGCGGTGGAGAAATCGGAGGTTGCGGCGGCGGAGAAAAACAGGGCTACGGCGGTGGCGATGAATGCTGAGATTCGACGGACGAAAGCTCGGTTGCTTGAAGAACTTCC...

CDS

Download CDS FASTA

804 bp · TkA06G471100|TK1151|CDS

ATGGGAGTAATCGATTTGATAACGAGAGTAGATGCGATATGCACAAAGTACGAGAAGTACGACGTAGACAAGCAAAAGGACGCCGCCAACAATATCAATCGGAACGATGCATTTGCCGGACTTTACACCGCCATCGAATCCGATCTGAATCAAGCGGTGGAGAAATCGGAGGTTGCGGCGGCGGAGAAAAACAGGGCTACGGCGGTGGCGATGAATGCTGAGATTCGACGGACGAAAGCTCGGTTGCTTGAAGAACTTCC...

Protein

Download Protein FASTA

267 aa · TkA06G471100|TK1151|PROTEIN

MGVIDLITRVDAICTKYEKYDVDKQKDAANNINRNDAFAGLYTAIESDLNQAVEKSEVAAAEKNRATAVAMNAEIRRTKARLLEELPKLQRLAFKKVKGLSKDELEARNELVLALKERIEVVPDGTTTKARPTNGLESSSSNGKIIFGSMQVSDETFDNNYYQHTDETKNFRQEYEMRRLRQDEGLDVIAEGLGTLKNMAQDMQEEVVRQVPLMDEIDDKVDRAASDLRNTNIRLKDTVTKLRSSRNFCVDIILLCLILG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G471100`
TK1151 ID	TkA06G471100
OH-1004 ID	LXL04_022630
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G471100

Location Chr06:116516977-116520713 (+)

Description Similar to SYP71: Syntaxin-71

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g09740`	Vesicle trafficking protein that functions in the secretory pathway.	No verified direct reference in this release
`At3g61450`	Vesicle trafficking protein that functions in the secretory pathway.	No verified direct reference in this release
`At3g45280`	Vesicle trafficking protein that functions in the secretory pathway.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022630 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006612 protein targeting to membrane Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006906 vesicle fusion Biological Process

GO:0048278 vesicle docking Biological Process

GO:0005634 nucleus Cellular Component

GO:0005768 endosome Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009504 cell plate Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT3G09740

ath:AT3G45280

ath:AT3G61450

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.328

Rank 1 · TkA06G471100 · TK1151

Lysosome / Vacuole0.236

Rank 2 · TkA06G471100 · TK1151

Golgi apparatus0.214

Rank 3 · TkA06G471100 · TK1151

Cytoplasm0.210

Rank 4 · TkA06G471100 · TK1151

Endoplasmic reticulum0.164

Rank 5 · TkA06G471100 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29997SPC25_N10-101 aa

PF05010TACC_C38-81 aa

PF05739SNARE49-64 aa

PF15564Imm25130-160 aa

PF05010TACC_C150-246 aa

PF07516SecA_SW155-211 aa

PF29997SPC25_N161-210 aa

PF05739SNARE181-255 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G471100	`PF29997`	SPC25_N	10	101	7.0	7.7
TkA06G471100	`PF05010`	TACC_C	38	81	0.042	14.3
TkA06G471100	`PF05739`	SNARE	49	64	4.5e-16	59.2
TkA06G471100	`PF15564`	Imm25	130	160	0.079	13.6
TkA06G471100	`PF05010`	TACC_C	150	246	0.042	14.3
TkA06G471100	`PF07516`	SecA_SW	155	211	0.39	11.5
TkA06G471100	`PF29997`	SPC25_N	161	210	7.0	7.7
TkA06G471100	`PF05739`	SNARE	181	255	4.5e-16	59.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SF29`	Arabidopsis thaliana	sp\|Q9SF29\|SYP71_ARATH Syntaxin-71	63.200%	Swiss-Prot	High
`Q94KK5`	Arabidopsis thaliana	sp\|Q94KK5\|SYP73_ARATH Syntaxin-73	61.000%	Swiss-Prot	High
`Q94KK6`	Arabidopsis thaliana	sp\|Q94KK6\|SYP72_ARATH Syntaxin-72	53.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card