LXL04_022630 | RubberDandelionOmics

Gene overview

LXL04_022630

Reference: OH-1004 Chr: Chr05 Coordinates: 3452876-3456985 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

798 bp · LXL04_022630|LXL04_022630|OH1004|cDNA

ATGGGAGTAATCGATTTGATAACGAGAGTAGATGCGATATGCACAAAGTACGAGAAGTACGACGTAGACAAGCAAAAGGACGCCGCCAACAATATCAATCGGAACGATGCATTTGCCGGACTTTACACCGCCATCGAATCCGATCTGAATCAAGCGGTGGAGAAATCGGAGGTTGCGGCGGCGGAGAAAAACAGGGCTACGGCGGTGGCGATGAATGCTGAGATTCGACGGACGAAAGCTCGGTTGCTTGAAGAACTTCC...

CDS

Download CDS FASTA

798 bp · LXL04_022630|LXL04_022630|OH1004|CDS

ATGGGAGTAATCGATTTGATAACGAGAGTAGATGCGATATGCACAAAGTACGAGAAGTACGACGTAGACAAGCAAAAGGACGCCGCCAACAATATCAATCGGAACGATGCATTTGCCGGACTTTACACCGCCATCGAATCCGATCTGAATCAAGCGGTGGAGAAATCGGAGGTTGCGGCGGCGGAGAAAAACAGGGCTACGGCGGTGGCGATGAATGCTGAGATTCGACGGACGAAAGCTCGGTTGCTTGAAGAACTTCC...

Protein

Download Protein FASTA

265 aa · LXL04_022630|LXL04_022630|OH1004|PROTEIN

MGVIDLITRVDAICTKYEKYDVDKQKDAANNINRNDAFAGLYTAIESDLNQAVEKSEVAAAEKNRATAVAMNAEIRRTKARLLEELPKLQRLAFKKVKGLSKDELEARNELVLALKERIEVVPDGTTTKARPTNGLESSSSNGKIIFGSMQDETFDNNYYQHTDETKNFRQEYEMRRLRQDEGLDVIAEGLGTLKNMAQDMQEEVVRQVPLMDEIDDKVDRAASDLRNTNIRLKDTVTKLRSSRNFCVDIILLCLILGIA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022630`
TK1151 ID	TkA06G471100
OH-1004 ID	LXL04_022630
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022630

Location Chr05:3452876-3456985 (-)

Description Similar to SYP71: Syntaxin-71

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g09740`	Vesicle trafficking protein that functions in the secretory pathway.	No verified direct reference in this release
`At3g45280`	Vesicle trafficking protein that functions in the secretory pathway.	No verified direct reference in this release
`At3g61450`	Vesicle trafficking protein that functions in the secretory pathway.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022630 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006612 protein targeting to membrane Biological Process

GO:0006886 intracellular protein transport Biological Process

GO:0006906 vesicle fusion Biological Process

GO:0048278 vesicle docking Biological Process

GO:0005634 nucleus Cellular Component

GO:0005768 endosome Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009504 cell plate Cellular Component

GO:0009506 plasmodesma Cellular Component

KEGG gene cross-reference

ath:AT3G09740

ath:AT3G45280

ath:AT3G61450

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.331

Rank 1 · LXL04_022630 · OH-1004

Lysosome / Vacuole0.239

Rank 2 · LXL04_022630 · OH-1004

Golgi apparatus0.208

Rank 3 · LXL04_022630 · OH-1004

Cytoplasm0.206

Rank 4 · LXL04_022630 · OH-1004

Endoplasmic reticulum0.162

Rank 5 · LXL04_022630 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05739.27SNARE179-253 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022630	`PF05739.27`	SNARE	179	253	4.5e-16	59.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SF29`	Arabidopsis thaliana	Syntaxin-71	63.258%	Swiss-Prot	strong database homology
`Q94KK6`	Arabidopsis thaliana	Syntaxin-72	54.340%	Swiss-Prot	strong database homology
`Q94KK5`	Arabidopsis thaliana	Syntaxin-73	60.755%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card