RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA06G465980
Reference: TK1151 Chr: Chr06 Coordinates: 115301738-115302313 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

576 bp · TkA06G465980|TK1151|cDNA

ATGTTCGAGTTGGGCATTTTGAGCTTCAATCATTTGTTGTTGACTCTCCCAAAGCTTTCGTTGTTCTTCGAGCATACTTTCGCGTTTCTTTTCTTTCCTTTCGGCTCTTTCTTTTGCAAAAGCCACCGATTCTTTCCACGTACCGACCAAAGGATCTTCGCTAGCCTCGCTAGCAACACTTTTCCCCGCCTTCTTTGCCTTGTCTCTTCCCGCAGGCCGCATTGTCACCGGTGGCGGCTCGAATTCGGTCTCCTCGTTCG...

CDS

Download CDS FASTA

576 bp · TkA06G465980|TK1151|CDS

ATGTTCGAGTTGGGCATTTTGAGCTTCAATCATTTGTTGTTGACTCTCCCAAAGCTTTCGTTGTTCTTCGAGCATACTTTCGCGTTTCTTTTCTTTCCTTTCGGCTCTTTCTTTTGCAAAAGCCACCGATTCTTTCCACGTACCGACCAAAGGATCTTCGCTAGCCTCGCTAGCAACACTTTTCCCCGCCTTCTTTGCCTTGTCTCTTCCCGCAGGCCGCATTGTCACCGGTGGCGGCTCGAATTCGGTCTCCTCGTTCG...

Protein

Download Protein FASTA

191 aa · TkA06G465980|TK1151|PROTEIN

MFELGILSFNHLLLTLPKLSLFFEHTFAFLFFPFGSFFCKSHRFFPRTDQRIFASLASNTFPRLLCLVSSRRPHCHRWRLEFGLLVRVVGRIVVEVEIETMLRFRCSRPFVGIGGIGPHVRSTCFFPSYPLVKRQSPRLVVAKLFVTISSFINRPRRRIGIELVRPTSILITHFVESTREIRDGLFHVTPF

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA06G465980
TK1151 IDTkA06G465980
OH-1004 IDLXL04_018322
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)91.200
Protein coverage (%)TK1151 94.764 / OH-1004 29.452
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA06G465980
LocationChr06:115301738-115302313 (+)
DescriptionSimilar to HCF101: Fe-S cluster assembly factor HCF101, chloroplastic
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_018322 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0016226 iron-sulfur cluster assembly Biological Process
GO:0032981 mitochondrial respiratory chain complex I assembly Biological Process
GO:0005739 mitochondrion Cellular Component
GO:0005743 mitochondrial inner membrane Cellular Component
GO:0005829 cytosol Cellular Component
GO:0009507 chloroplast Cellular Component
GO:0009570 chloroplast stroma Cellular Component
GO:0005524 ATP binding Molecular Function
GO:0016887 ATP hydrolysis activity Molecular Function
GO:0046872 metal ion binding Molecular Function
GO:0051536 iron-sulfur cluster binding Molecular Function
GO:0051539 4 iron, 4 sulfur cluster binding Molecular Function
KEGG gene cross-reference
ath:AT3G24430
dosa:Os01g0719700
dra:DR_0998
hin:HI_1277
yli:2907193
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.362
Rank 1 · TkA06G465980 · TK1151
Nucleus0.299
Rank 2 · TkA06G465980 · TK1151
Mitochondrion0.250
Rank 3 · TkA06G465980 · TK1151
Cell membrane0.058
Rank 4 · TkA06G465980 · TK1151
Endoplasmic reticulum0.053
Rank 5 · TkA06G465980 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser