LXL04_018322 | RubberDandelionOmics

Gene overview

LXL04_018322

Reference: OH-1004 Chr: Chr04 Coordinates: 11557707-11562311 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1755 bp · LXL04_018322|LXL04_018322|OH1004|cDNA

ATGCCGAGATCCAAGCCTAGATCGCTCGGCAAAAACGTGATCACCGAGAACCGATACCGAAAAGCTGCTAGAGGAAGACTGCCGAGATCCGGAAAATGCCGAGTACCGAGCCTAGTTCCGGGTATTCGACGAGAAGCTTGGTCGCTATGCGAGAACCAATCCGGATCTGAAAGTGAAGAACAGCGACAAACAGCAACAAAAACTCCGTTTTTCttcgtttttcttccaaaaacacttCGATTTAGCCACaaaaacgaaga...

CDS

Download CDS FASTA

1755 bp · LXL04_018322|LXL04_018322|OH1004|CDS

ATGCCGAGATCCAAGCCTAGATCGCTCGGCAAAAACGTGATCACCGAGAACCGATACCGAAAAGCTGCTAGAGGAAGACTGCCGAGATCCGGAAAATGCCGAGTACCGAGCCTAGTTCCGGGTATTCGACGAGAAGCTTGGTCGCTATGCGAGAACCAATCCGGATCTGAAAGTGAAGAACAGCGACAAACAGCAACAAAAACTCCGTTTTTCTTCGTTTTTCTTCCAAAAACACTTCGATTTAGCCACAAAAACGAAGA...

Protein

Download Protein FASTA

584 aa · LXL04_018322|LXL04_018322|OH1004|PROTEIN

MPRSKPRSLGKNVITENRYRKAARGRLPRSGKCRVPSLVPGIRREAWSLCENQSGSESEEQRQTATKTPFFFVFLPKTLRFSHKNEDLEDKNDPNAPQTSSLDIDYMIEQECGKLMNDHYVMGDVGKLKVAVNLAYTLAGMGARVGIFDADVYGPSLPTMRKDHYSTRIHRSEDGIFWIWCTRACNYAGYIGFCCHKSTTYHHRVFYKQGKLDHLVIDMPCGTRDIQLTLCHLRTCVILMPMENDFTRLVEVVEQFGIPH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018322`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018322

Location Chr04:11557707-11562311 (-)

Description Similar to HCF101: Fe-S cluster assembly factor HCF101, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g24430`	Required for photosystem I (PSI) biosynthesis and assembly.	A novel protein for photosystem I biogenesis.2004 · DOI: 10.1074/jbc.m309246200 The universally conserved HCF101 protein is involved in assembly of [4Fe-4S]-cluster-containing complexes in Arabidopsis thaliana chloroplasts.2004 · DOI: 10.1046/j.1365-313x.2003.01952.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0719700`	Required for photosystem I (PSI) biosynthesis and assembly.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018322 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016226 iron-sulfur cluster assembly Biological Process

GO:0032981 mitochondrial respiratory chain complex I assembly Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0051536 iron-sulfur cluster binding Molecular Function

GO:0051539 4 iron, 4 sulfur cluster binding Molecular Function

KEGG gene cross-reference

ath:AT3G24430

dosa:Os01g0719700

dra:DR_0998

hin:HI_1277

yli:2907193

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.400

Rank 1 · LXL04_018322 · OH-1004

Nucleus0.311

Rank 2 · LXL04_018322 · OH-1004

Mitochondrion0.229

Rank 3 · LXL04_018322 · OH-1004

Cell membrane0.107

Rank 4 · LXL04_018322 · OH-1004

Endoplasmic reticulum0.080

Rank 5 · LXL04_018322 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10609.16ParA123-164 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018322	`PF10609.16`	ParA	123	164	3.2e-19	70.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6STH5`	Arabidopsis thaliana	Fe-S cluster assembly factor HCF101, chloroplastic	40.465%	Swiss-Prot	weak database homology
`Q0JJS8`	Oryza sativa subsp. japonica	Fe-S cluster assembly factor HCF101, chloroplastic	39.171%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card