RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA06G452110
Reference: TK1151 Chr: Chr06 Coordinates: 111789802-111795509 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1889 bp · TkA06G452110|TK1151|cDNA

TCCTAGTCCATATATGTAGAACCTACAGCCAAAAGGCAGCTGTTCCCTCTCTCTTTCTCTATAATGCACCACATATATTCACACCCCAACAACAGTATTTCAGGATCTTTCTTCAAACATCAACAGATTCTTTAAAATGAGTCAGTGTGTACCAAGTTGGGATGATGATCATAACTCACACCCAGAGCGTCTCAAGGTCAACTCCATGGCTTCCATGATCGATGTTCCGAAATTAGATTACGAAGTGGCGGAATTAACAT...

CDS

Download CDS FASTA

1389 bp · TkA06G452110|TK1151|CDS

ATGAGTCAGTGTGTACCAAGTTGGGATGATGATCATAACTCACACCCAGAGCGTCTCAAGGTCAACTCCATGGCTTCCATGATCGATGTTCCGAAATTAGATTACGAAGTGGCGGAATTAACATGGAAAAATGGACAAGTAGCCATGCACGGCTTAGGTCCGCCGCGTGTGGTAAGCAAACCCCATACCTCCACAACTGGTTCTACCAGATACACCTGGGATAAGCCACGCGCCGCCGAGACCCTCGAGGCAATAGTCAA...

Protein

Download Protein FASTA

462 aa · TkA06G452110|TK1151|PROTEIN

MSQCVPSWDDDHNSHPERLKVNSMASMIDVPKLDYEVAELTWKNGQVAMHGLGPPRVVSKPHTSTTGSTRYTWDKPRAAETLEAIVNQATLLPYGISQMEFYAGDLVPWIDQQTSNLATGTTSASITMTMDALVPSSNTQLHTLRSAANGSAILASARVGSCSGDQSRFVDQRVARGGGAAAHEWSSCKDQSVSGSGTFGMESGRQFTVEFCEREFGVKAFTSTSNGSPENTISGKRSTQSTSPDEHDSVGQSKRQKVSG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA06G452110
TK1151 IDTkA06G452110
OH-1004 IDLXL04_022758
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)97.800
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA06G452110
LocationChr06:111789802-111795509 (-)
DescriptionSimilar to UNE10: Transcription factor UNE10
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g00050 Transcription factor binding to G-box elements (5'-CACGTG-3') in target genes promoters, particularly in far-red light but barely in the dark.
PHYTOCHROME INTERACTING FACTOR8 Inhibits Phytochrome A-Mediated Far-Red Light Responses in Arabidopsis.2020 · DOI: 10.1105/tpc.19.00515
At5g67110 Required for the dehiscence of fruit, especially for the separation of the valve cells from the replum. No verified direct reference in this release
At5g61270 Transcription factor acting negatively in the phytochrome B signaling pathway under prolonged red light.
The Arabidopsis phytochrome-interacting factor PIF7, together with PIF3 and PIF4, regulates responses to prolonged red light by modulating phyB levels.2008 · DOI: 10.1105/tpc.107.052142
At4g36930 Transcription factor that plays a role in floral organogenesis. No verified direct reference in this release
At2g20180 Transcription activator.
SOMNUS, a CCCH-type zinc finger protein in Arabidopsis, negatively regulates light-dependent seed germination downstream of PIL5.2008 · DOI: 10.1105/tpc.108.058859

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_022758 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0006783 heme biosynthetic process Biological Process
GO:0009408 response to heat Biological Process
GO:0009409 response to cold Biological Process
GO:0009416 response to light stimulus Biological Process
GO:0009567 double fertilization forming a zygote and endosperm Biological Process
GO:0009637 response to blue light Biological Process
GO:0009686 gibberellin biosynthetic process Biological Process
GO:0009704 de-etiolation Biological Process
GO:0009733 response to auxin Biological Process
GO:0009737 response to abscisic acid Biological Process
KEGG gene cross-reference
ath:AT2G20180
ath:AT4G00050
ath:AT5G67110
dosa:Os01g0286100
dosa:Os03g0782500
osa:4327916
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.981
Rank 1 · TkA06G452110 · TK1151
Cytoplasm0.084
Rank 2 · TkA06G452110 · TK1151
Cell membrane0.021
Rank 3 · TkA06G452110 · TK1151
Endoplasmic reticulum0.012
Rank 4 · TkA06G452110 · TK1151
Plastid0.009
Rank 5 · TkA06G452110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09726Macoilin208-332 aa
PF02535Zip234-284 aa
PF07526POX255-334 aa
PF00010HLH283-328 aa
PF30769FTR1_4HB284-332 aa
PF23177bHLH_IRO3285-338 aa
PF23173bHLH_SAC51286-330 aa
PF23176bHLH_LHW290-329 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA06G452110PF09726Macoilin2083320.439.9
TkA06G452110PF02535Zip2342846.46.6
TkA06G452110PF07526POX2553340.02315.9
TkA06G452110PF00010HLH2833282e-1350.6
TkA06G452110PF30769FTR1_4HB2843320.0614.7
TkA06G452110PF23177bHLH_IRO32853381e-0526.5
TkA06G452110PF23173bHLH_SAC512863302.5e-0834.4
TkA06G452110PF23176bHLH_LHW2903290.02215.4
TkA06G452110PF02535Zip3463706.46.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8GZ38Arabidopsis thalianasp|Q8GZ38|UNE10_ARATH Transcription factor UNE1048.000%Swiss-ProtMedium
Q9FHA2Arabidopsis thalianasp|Q9FHA2|ALC_ARATH Transcription factor ALC63.800%Swiss-ProtLow
Q570R7Arabidopsis thalianasp|Q570R7|PIF7_ARATH Transcription factor PIF746.700%Swiss-ProtLow
Q9FUA4Arabidopsis thalianasp|Q9FUA4|SPT_ARATH Transcription factor SPATULA58.600%Swiss-ProtLow
Q8GZM7Arabidopsis thalianasp|Q8GZM7|PIF1_ARATH Transcription factor PIF163.200%Swiss-ProtLow

JBrowse

View in Genome Browser