LXL04_022758 | RubberDandelionOmics

Gene overview

LXL04_022758

Reference: OH-1004 Chr: Chr05 Coordinates: 8050657-8056129 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1392 bp · LXL04_022758|LXL04_022758|OH1004|cDNA

ATGAGTCAGTGTGTACCAAGTTGGGATGATGATCATAACTCACACCCTGGGCGTCTCAAGGTCAACTCCATGGCTTCCATGATCGATGTTCCAAAATTAGATTACGAAGTGGCGGAATTAACATGGAAAAATGGACAAGTAGCCATGCACGGCTTAGGTCCGCCGCGCGTGGTAAGCAAACCCCATACCTCCACAACTGGTTCTACCAGATACACCTGGGATAAGCCACGCGCCGCCGAGACCCTCGAGGCAATAGTCAA...

CDS

Download CDS FASTA

1392 bp · LXL04_022758|LXL04_022758|OH1004|CDS

ATGAGTCAGTGTGTACCAAGTTGGGATGATGATCATAACTCACACCCTGGGCGTCTCAAGGTCAACTCCATGGCTTCCATGATCGATGTTCCAAAATTAGATTACGAAGTGGCGGAATTAACATGGAAAAATGGACAAGTAGCCATGCACGGCTTAGGTCCGCCGCGCGTGGTAAGCAAACCCCATACCTCCACAACTGGTTCTACCAGATACACCTGGGATAAGCCACGCGCCGCCGAGACCCTCGAGGCAATAGTCAA...

Protein

Download Protein FASTA

463 aa · LXL04_022758|LXL04_022758|OH1004|PROTEIN

MSQCVPSWDDDHNSHPGRLKVNSMASMIDVPKLDYEVAELTWKNGQVAMHGLGPPRVVSKPHTSTTGSTRYTWDKPRAAETLEAIVNQATLLPYGISQMEFYAGDLVPWIDQQTSNLATGTTSASITMTMDALVPSSNTQLHTLRSAAKGSAILASARVGSCSGDQSGFVDQRVARGGAPAAHEWSSCKDQSVSGSGTFGMESGRQFTVESCEREFGVKAFTSTSNGSPENTISGKRSTQSTSPDEHDSVGQSKRQKVSG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022758`
TK1151 ID	TkA06G452110
OH-1004 ID	LXL04_022758
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022758

Location Chr05:8050657-8056129 (+)

Description Similar to UNE10: Transcription factor UNE10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g00050`	Transcription factor binding to G-box elements (5'-CACGTG-3') in target genes promoters, particularly in far-red light but barely in the dark.	PHYTOCHROME INTERACTING FACTOR8 Inhibits Phytochrome A-Mediated Far-Red Light Responses in Arabidopsis.2020 · DOI: 10.1105/tpc.19.00515
`At5g67110`	Required for the dehiscence of fruit, especially for the separation of the valve cells from the replum.	No verified direct reference in this release
`At2g20180`	Transcription activator.	SOMNUS, a CCCH-type zinc finger protein in Arabidopsis, negatively regulates light-dependent seed germination downstream of PIL5.2008 · DOI: 10.1105/tpc.108.058859

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0782500`	Transcription factor that may act as negative regulator of phyB-dependent light signal transduction.	Characterization of a set of phytochrome-interacting factor-like bHLH proteins in Oryza sativa.2007 · DOI: 10.1271/bbb.60643 Rice phytochrome-interacting factor-like protein OsPIL1 functions as a key regulator of internode elongation and induces a morphological response to drought stress.2012 · DOI: 10.1073/pnas.1207324109
`Os01g0286100`	Transcription factor that may act as negative regulator of phyB-dependent light signal transduction.	Characterization of a set of phytochrome-interacting factor-like bHLH proteins in Oryza sativa.2007 · DOI: 10.1271/bbb.60643

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022758 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006783 heme biosynthetic process Biological Process

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009567 double fertilization forming a zygote and endosperm Biological Process

GO:0009637 response to blue light Biological Process

GO:0009686 gibberellin biosynthetic process Biological Process

GO:0009704 de-etiolation Biological Process

GO:0009733 response to auxin Biological Process

GO:0009737 response to abscisic acid Biological Process

KEGG gene cross-reference

ath:AT2G20180

ath:AT4G00050

ath:AT5G67110

dosa:Os01g0286100

dosa:Os03g0782500

osa:4327916

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.980

Rank 1 · LXL04_022758 · OH-1004

Cytoplasm0.088

Rank 2 · LXL04_022758 · OH-1004

Cell membrane0.021

Rank 3 · LXL04_022758 · OH-1004

Endoplasmic reticulum0.012

Rank 4 · LXL04_022758 · OH-1004

Plastid0.009

Rank 5 · LXL04_022758 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010.32HLH283-328 aa

PF23177.2bHLH_IRO3285-338 aa

PF23173.3bHLH_SAC51286-330 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022758	`PF00010.32`	HLH	283	328	2.2e-13	50.5
LXL04_022758	`PF23177.2`	bHLH_IRO3	285	338	8.4e-06	26.8
LXL04_022758	`PF23173.3`	bHLH_SAC51	286	330	2.5e-08	34.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GZ38`	Arabidopsis thaliana	Transcription factor UNE10	47.124%	Swiss-Prot	moderate database homology
`Q9FHA2`	Arabidopsis thaliana	Transcription factor ALC	37.766%	Swiss-Prot	weak database homology
`Q8GZM7`	Arabidopsis thaliana	Transcription factor PIF1	38.208%	Swiss-Prot	weak database homology
`Q10CH5`	Oryza sativa subsp. japonica	Transcription factor PHYTOCHROME INTERACTING FACTOR-LIKE 13	41.096%	Swiss-Prot	weak database homology
`Q0JNI9`	Oryza sativa subsp. japonica	Transcription factor PHYTOCHROME INTERACTING FACTOR-LIKE 15	57.317%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card