TkA06G431470 | RubberDandelionOmics

Gene overview

TkA06G431470

Reference: TK1151 Chr: Chr06 Coordinates: 106783454-106785393 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1558 bp · TkA06G431470|TK1151|cDNA

ATCGCTTTGTTTCCATCTTCTTCAGGGGAATTATGCTTAAATGGAATCGCTCTTGAAATCCGGAATCTTTTTTCTCGTTATTCTTTACGTGGAGAGATTTTAAACGTTACTTGTCGGTTACTTTTTACAATATTACATTCGGTCAATTCGGATTTACTCACTGATCACGAAGCTTGGATTTCAATAGCAACAGAGTTGATACACTATTTGATCTCCACAATCGGTGAGAACGGGTGCACTCATGAAGCTCATCTTGTAAT...

CDS

Download CDS FASTA

1326 bp · TkA06G431470|TK1151|CDS

ATCGCTTTGTTTCCATCTTCTTCAGGGGAATTATGCTTAAATGGAATCGCTCTTGAAATCCGGAATCTTTTTTCTCGTTATTCTTTACGTGGAGAGATTTTAAACGTTACTTGTCGGTTACTTTTTACAATATTACATTCGGTCAATTCGGATTTACTCACTGATCACGAAGCTTGGATTTCAATAGCAACAGAGTTGATACACTATTTGATCTCCACAATCGGTGAGAACGGGTGCACTCATGAAGCTCATCTTGTAAT...

Protein

Download Protein FASTA

441 aa · TkA06G431470|TK1151|PROTEIN

IALFPSSSGELCLNGIALEIRNLFSRYSLRGEILNVTCRLLFTILHSVNSDLLTDHEAWISIATELIHYLISTIGENGCTHEAHLVIGILSLILRHSLHQNLLEASKTILMNTQLISLVNKMIREACVKGPALFDHDEATQTGEALIFLLFLNYFSHRSVHVVVPGIEDVRSLLDSENKTQQSLFYINIHCHDLCRLLHFGSTPVKLISSYCLLQLFQTITQQKIKQNARHIRSIISILQGLIFHSDITIAVNCALGLSM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G431470`
TK1151 ID	TkA06G431470
OH-1004 ID	LXL04_014517
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.900
Protein coverage (%)	TK1151 100.000 / OH-1004 34.426 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G431470

Location Chr06:106783454-106785393 (+)

Description Similar to PRD1: Protein PUTATIVE RECOMBINATION INITIATION DEFECT 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g14180`	Involved in DNA cleavage that forms the double-strand breaks (DSB) that initiate meiotic recombination.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014517 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0042138 meiotic DNA double-strand break formation Biological Process

GO:0051026 chiasma assembly Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0016787 hydrolase activity Molecular Function

GO:0042803 protein homodimerization activity Molecular Function

KEGG gene cross-reference

ath:AT4G14180

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.473

Rank 1 · TkA06G431470 · TK1151

Nucleus0.424

Rank 2 · TkA06G431470 · TK1151

Golgi apparatus0.084

Rank 3 · TkA06G431470 · TK1151

Cell membrane0.074

Rank 4 · TkA06G431470 · TK1151

Endoplasmic reticulum0.067

Rank 5 · TkA06G431470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30216TPR_PRD1_C1-425 aa

PF25259DUF786022-45 aa

PF06127Mpo1-like53-76 aa

PF25259DUF786084-119 aa

PF25259DUF7860135-152 aa

PF06127Mpo1-like183-218 aa

PF25259DUF7860318-339 aa

PF02093Gag_p30347-424 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G431470	`PF30216`	TPR_PRD1_C	1	425	3e-168	561.1
TkA06G431470	`PF25259`	DUF7860	22	45	0.18	12.7
TkA06G431470	`PF06127`	Mpo1-like	53	76	0.24	12.3
TkA06G431470	`PF25259`	DUF7860	84	119	0.18	12.7
TkA06G431470	`PF25259`	DUF7860	135	152	0.18	12.7
TkA06G431470	`PF06127`	Mpo1-like	183	218	0.24	12.3
TkA06G431470	`PF25259`	DUF7860	318	339	0.18	12.7
TkA06G431470	`PF02093`	Gag_p30	347	424	0.043	14.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23277`	Arabidopsis thaliana	sp\|O23277\|PRD1_ARATH Protein PUTATIVE RECOMBINATION INITIATION DEFECT 1	40.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card