TkA06G416250 | RubberDandelionOmics

Gene overview

TkA06G416250

Reference: TK1151 Chr: Chr06 Coordinates: 103016165-103023232 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2502 bp · TkA06G416250|TK1151|cDNA

ATGTCATTATCATTCGCATATATCTCCGACCTATTTCACGGCTCCAGAGCAATCCCTCCCAGGAAGAGGCCGGCAAGGATTCAGATTCCATTTGCACCGTTGAGTATTACGGAAGAGGTTTCGAAGCCGAACGATGAAGTAGCAGAGATCGATGAGGAAGGGGAGGAGTATTCTGTGTATTGTAAAAGAGGGAAAAGAGGATCCATGGAGGACCGATATTCTGCCGTTGTTGATCTTCAAGGAGATACCAAACAGGAGCA...

CDS

Download CDS FASTA

2502 bp · TkA06G416250|TK1151|CDS

ATGTCATTATCATTCGCATATATCTCCGACCTATTTCACGGCTCCAGAGCAATCCCTCCCAGGAAGAGGCCGGCAAGGATTCAGATTCCATTTGCACCGTTGAGTATTACGGAAGAGGTTTCGAAGCCGAACGATGAAGTAGCAGAGATCGATGAGGAAGGGGAGGAGTATTCTGTGTATTGTAAAAGAGGGAAAAGAGGATCCATGGAGGACCGATATTCTGCCGTTGTTGATCTTCAAGGAGATACCAAACAGGAGCA...

Protein

Download Protein FASTA

833 aa · TkA06G416250|TK1151|PROTEIN

MSLSFAYISDLFHGSRAIPPRKRPARIQIPFAPLSITEEVSKPNDEVAEIDEEGEEYSVYCKRGKRGSMEDRYSAVVDLQGDTKQEQLGHFTEENCVRISTSNRMHKVKQANQNEGFGPILDFIKRNNSKRFFKDDMENVIKYQWLDTNKNIQMYKELTESSLPLLFPGSFMLYGARYGVFTGADERLLHSLREVLDAPNVMNIIKDTKAAQEVRPLKDFFTMLTNDLHRYGPKHVEVAHERMALQTLLITDDFFRFILM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G416250`
TK1151 ID	TkA06G416250
OH-1004 ID	LXL04_040237
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	66.600
Protein coverage (%)	TK1151 60.864 / OH-1004 54.670 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G416250

Location Chr06:103016165-103023232 (-)

Description Similar to PIF1: ATP-dependent DNA helicase PIF1 (Trypanosoma brucei brucei (strain 927/4 GUTat10.1)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g58390`	Component of the Pelota-HBS1L complex, a complex that recognizes stalled ribosomes and triggers the No-Go Decay (NGD) pathway.	No verified direct reference in this release
`At4g27650`	Component of the Pelota-HBS1L complex, a complex that recognizes stalled ribosomes and triggers the No-Go Decay (NGD) pathway.	No verified direct reference in this release
`At1g07160`	Probable protein phosphatase 2C 2.	No verified direct reference in this release
`At2g30020`	Protein phosphatase that negatively regulates defense respones.	No verified direct reference in this release
`At2g40180`	Probable protein phosphatase 2C 30.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_040237 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0001117 protein-DNA-RNA complex disassembly Biological Process

GO:0006281 DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0007004 telomere maintenance via telomerase Biological Process

GO:0032211 negative regulation of telomere maintenance via telomerase Biological Process

GO:0051276 chromosome organization Biological Process

GO:0000781 chromosome, telomeric region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

hsa:80119

prw:PsycPRwf_1560

tbr:Tb11.01.6420

tbr:Tb11.02.4730

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.511

Rank 1 · TkA06G416250 · TK1151

Cytoplasm0.352

Rank 2 · TkA06G416250 · TK1151

Cell membrane0.096

Rank 3 · TkA06G416250 · TK1151

Endoplasmic reticulum0.067

Rank 4 · TkA06G416250 · TK1151

Mitochondrion0.065

Rank 5 · TkA06G416250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08646Rep_fac-A_C68-114 aa

PF03465eRF1_3211-256 aa

PF08646Rep_fac-A_C511-591 aa

PF16099RMI1_C525-567 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G416250	`PF08646`	Rep_fac-A_C	68	114	0.0017	18.9
TkA06G416250	`PF03465`	eRF1_3	211	256	9.4e-06	26.8
TkA06G416250	`PF08646`	Rep_fac-A_C	511	591	0.0017	18.9
TkA06G416250	`PF16099`	RMI1_C	525	567	0.086	13.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M2H7`	Arabidopsis thaliana	sp\|Q9M2H7\|PEL2_ARATH Protein PELOTA 2	73.900%	Swiss-Prot	Low
`Q9ZT87`	Arabidopsis thaliana	sp\|Q9ZT87\|PEL1_ARATH Protein PELOTA 1	71.000%	Swiss-Prot	Low
`Q8RX37`	Arabidopsis thaliana	sp\|Q8RX37\|P2C02_ARATH Probable protein phosphatase 2C 2	48.100%	Swiss-Prot	Low
`O80871`	Arabidopsis thaliana	sp\|O80871\|P2C25_ARATH Probable protein phosphatase 2C 25	47.400%	Swiss-Prot	Low
`Q9XEE8`	Arabidopsis thaliana	sp\|Q9XEE8\|P2C30_ARATH Probable protein phosphatase 2C 30	46.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card