TkA06G391020 | RubberDandelionOmics

Gene overview

TkA06G391020

Reference: TK1151 Chr: Chr06 Coordinates: 96907306-96920973 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1652 bp · TkA06G391020|TK1151|cDNA

TTTAAACTCAAAAGGAGAAGTAAAATCGGTTTTTGTTAACGAAGACAACTTATTTCAAACTTCTGAAGCAAATCCAAAGGACACAGCATCTACAAGTAAAATTCAAGTCGCCCAATATTTGTTTGGCCTTGCTAATTCAAGTCACACCCCTCATCCCAGTTCTACTCAGCGGGTGAGGATTTGTACGCGAATCATTCGAAAATCTGCTTATTAGTCTGGTTTATTTCTGATTTGTTTGGATTGGCATGAATAATCGCTTA...

CDS

Download CDS FASTA

3573 bp · TkA06G391020|TK1151|CDS

ATGATCACACTTCTATCGACGGCGTTGGCGGCGAACTTCTGTCAGAGGAGCTTACCGCAGTGCGTGCAATATTTCAAGAAGATTGCGACTTTGTCTCAGAGTCTCCCCCGAATCAAGATCAAGCTAAGGCCATATTCACAGGATTCAGGTTATGAGGATTTAGACGTATCTGCCCTTCTTTCGATAAGATTTTTACCTGGATACCCTTACAAGTGCCCAAAGCTACTGATAATACCAGAAAAAGGTTTATCAAAATCTGA...

Protein

Download Protein FASTA

1190 aa · TkA06G391020|TK1151|PROTEIN

MITLLSTALAANFCQRSLPQCVQYFKKIATLSQSLPRIKIKLRPYSQDSGYEDLDVSALLSIRFLPGYPYKCPKLLIIPEKGLSKSDADNLLSLLHDQANLNAREGRVMIYNLVEAAQEFLSEVVPLEQPHVPCATTDRPSKGPFVYGFIDLFMGSGESWPWGLSIEESNNKDNTLQLNDPHNEKKVNQIMKTGVVEDVDVDKVISHTERLDGLEEESKSNDSFTSSSEESVENASIGEDYLLEENTEEESDYGEIKSDN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G391020`
TK1151 ID	TkA06G391020
OH-1004 ID	LXL04_023165
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.900
Protein coverage (%)	TK1151 97.479 / OH-1004 95.789 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G391020

Location Chr06:96907306-96920973 (+)

Description Similar to GCN2: eIF-2-alpha kinase GCN2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g59410`	Metabolic-stress sensing protein kinase that phosphorylates the alpha subunit of eukaryotic translation initiation factor 2 eIF-2-alpha in response to low amino acid availability.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023165 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000077 DNA damage checkpoint signaling Biological Process

GO:0006412 translation Biological Process

GO:0006446 regulation of translational initiation Biological Process

GO:0006468 protein phosphorylation Biological Process

GO:0006521 regulation of amino acid metabolic process Biological Process

GO:0009635 response to herbicide Biological Process

GO:0009893 positive regulation of metabolic process Biological Process

GO:0010508 positive regulation of autophagy Biological Process

GO:0018105 peptidyl-serine phosphorylation Biological Process

GO:0031571 mitotic G1 DNA damage checkpoint signaling Biological Process

GO:0031589 cell-substrate adhesion Biological Process

GO:0032057 negative regulation of translational initiation in response to stress Biological Process

KEGG gene cross-reference

ath:AT3G59410

ddi:DDB_G0276829

sce:YDR283C

spo:2540500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.536

Rank 1 · TkA06G391020 · TK1151

Nucleus0.369

Rank 2 · TkA06G391020 · TK1151

Cell membrane0.097

Rank 3 · TkA06G391020 · TK1151

Golgi apparatus0.087

Rank 4 · TkA06G391020 · TK1151

Endoplasmic reticulum0.063

Rank 5 · TkA06G391020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05773RWD33-121 aa

PF12745HGTP_anticodon2241-267 aa

PF13095FTA2372-412 aa

PF00069Pkinase374-680 aa

PF07714PK_Tyr_Ser-Thr377-440 aa

PF01636APH405-433 aa

PF07714PK_Tyr_Ser-Thr487-677 aa

PF06293Kdo500-550 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G391020	`PF05773`	RWD	33	121	4e-12	47.0
TkA06G391020	`PF12745`	HGTP_anticodon2	241	267	9.5e-06	26.0
TkA06G391020	`PF13095`	FTA2	372	412	0.044	14.2
TkA06G391020	`PF00069`	Pkinase	374	680	2e-49	169.0
TkA06G391020	`PF07714`	PK_Tyr_Ser-Thr	377	440	6.6e-25	88.6
TkA06G391020	`PF01636`	APH	405	433	0.15	12.6
TkA06G391020	`PF07714`	PK_Tyr_Ser-Thr	487	677	6.6e-25	88.6
TkA06G391020	`PF06293`	Kdo	500	550	0.035	14.3
TkA06G391020	`PF14531`	Kinase-like	503	557	0.0032	17.5
TkA06G391020	`PF13095`	FTA2	510	544	0.044	14.2
TkA06G391020	`PF03109`	ABC1	525	564	0.0099	15.8
TkA06G391020	`PF01636`	APH	529	556	0.15	12.6
TkA06G391020	`PF13393`	tRNA-synt_His	838	1066	3.8e-10	40.2
TkA06G391020	`PF12745`	HGTP_anticodon2	917	929	9.5e-06	26.0
TkA06G391020	`PF12745`	HGTP_anticodon2	1085	1182	9.5e-06	26.0
TkA06G391020	`PF03129`	HGTP_anticodon	1089	1177	4.9e-09	36.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LX30`	Arabidopsis thaliana	sp\|Q9LX30\|GCN2_ARATH eIF-2-alpha kinase GCN2	60.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card