TkA06G298240 | RubberDandelionOmics

Gene overview

TkA06G298240

Reference: TK1151 Chr: Chr06 Coordinates: 75256658-75258252 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

531 bp · TkA06G298240|TK1151|cDNA

ATGAACGACCAGGCGGTCAGAAAGGGGACGATGGTCCCAAAAGCTGAGCCCAGCCGGGAGCAGCATAAGAGGAAACCCTGGAACAACAACAACAACAACAACAACAACAACAACAACCACAACGATAACCAACCCAAGAGGCAGCGCACCATTACTGCCTATGCCGCTGTGCCTGTCAATGCGGTAGCACCCCAAAACCAGTACGTGGGAAACCTTCCCAAGTGCAACAAATGCTACTATCACCATACCGGCGCCTGCCG...

CDS

Download CDS FASTA

531 bp · TkA06G298240|TK1151|CDS

ATGAACGACCAGGCGGTCAGAAAGGGGACGATGGTCCCAAAAGCTGAGCCCAGCCGGGAGCAGCATAAGAGGAAACCCTGGAACAACAACAACAACAACAACAACAACAACAACAACCACAACGATAACCAACCCAAGAGGCAGCGCACCATTACTGCCTATGCCGCTGTGCCTGTCAATGCGGTAGCACCCCAAAACCAGTACGTGGGAAACCTTCCCAAGTGCAACAAATGCTACTATCACCATACCGGCGCCTGCCG...

Protein

Download Protein FASTA

176 aa · TkA06G298240|TK1151|PROTEIN

MNDQAVRKGTMVPKAEPSREQHKRKPWNNNNNNNNNNNNHNDNQPKRQRTITAYAAVPVNAVAPQNQYVGNLPKCNKCYYHHTGACREIFCRSCKKKGHTARNCKGTPVGANIGVNRGCYGCGDTGHFQRDWPKAAGAANGRVFALGAREAIADQRCVMGAKSRETSSLSLAKLRH

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G298240`
TK1151 ID	TkA06G298240
OH-1004 ID	LXL04_015268
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	72.100
Protein coverage (%)	TK1151 99.432 / OH-1004 9.989 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G298240`
Location	Chr06:75256658-75258252 (+)
Description	Similar to POLD1: DNA polymerase delta catalytic subunit
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_015268` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006259 DNA metabolic process Biological Process GO:0006260 DNA replication Biological Process GO:0006261 DNA-templated DNA replication Biological Process GO:0006278 RNA-templated DNA biosynthetic process Biological Process GO:0006281 DNA repair Biological Process GO:0006287 base-excision repair, gap-filling Biological Process GO:0006297 nucleotide-excision repair, DNA gap filling Biological Process GO:0006303 double-strand break repair via nonhomologous end joining Biological Process GO:0043137 DNA replication, removal of RNA primer Biological Process GO:0045004 DNA replication proofreading Biological Process GO:0045005 DNA-templated DNA replication maintenance of fidelity Biological Process GO:0005634 nucleus Cellular Component
KEGG gene cross-reference	ath:AT5G63960 ddi:DDB_G0285381 dosa:Os11g0186400 gmx:548092 sce:YDL102W These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.527

Rank 1 · TkA06G298240 · TK1151

Cytoplasm0.512

Rank 2 · TkA06G298240 · TK1151

Extracellular0.059

Rank 3 · TkA06G298240 · TK1151

Endoplasmic reticulum0.052

Rank 4 · TkA06G298240 · TK1151

Cell membrane0.043

Rank 5 · TkA06G298240 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05053Menin10-56 aa

PF00098zf-CCHC74-78 aa

PF27939DUF836388-129 aa

PF00098zf-CCHC91-105 aa

PF00098zf-CCHC117-131 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G298240	`PF05053`	Menin	10	56	1.7	7.6
TkA06G298240	`PF00098`	zf-CCHC	74	78	0.00033	21.3
TkA06G298240	`PF27939`	DUF8363	88	129	0.036	14.6
TkA06G298240	`PF00098`	zf-CCHC	91	105	0.00033	21.3
TkA06G298240	`PF00098`	zf-CCHC	117	131	0.00033	21.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card