LXL04_015268 | RubberDandelionOmics

Gene overview

LXL04_015268

Reference: OH-1004 Chr: Chr03 Coordinates: 67283842-67297797 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5643 bp · LXL04_015268|LXL04_015268|OH1004|cDNA

ATGGCAGATGCTACAGTGCCGGGTCGTGGGCCTCGCCTGGTGGGCTTCGTGGACTGGGGCAGCGCTTGGGCTTCTGGTGGACTAGGCTGaaccagaagaggatccaaagctgccgaaacgtcaaacaaaaactatgtcgctagcatgcgagttcgagtccttgaagaggatcgagacatagatcgcataatcattactactaccaggactgatttagtcgatacccgagccagatcgacggacgtggaaagagggatagc...

CDS

Download CDS FASTA

5499 bp · LXL04_015268|LXL04_015268|OH1004|CDS

ATGCGAGTTCGAGTCCTTGAAGAGGATCGAGACATAGATCGCATAATCATTACTACTACCAGGACTGATTTAGTCGATACCCGAGCCAGATCGACGGACGTGGAAAGAGGGATAGCAGGTCTGCCAGGTCAGACTGATGCTACCAACACCTTGGCTCTTCTTGCTGAAGGCCGTTCCCCTCATGACTTCGCTGGAACCGGAAGTGTCATCGAACTGACATGCTGGTTTGAGAAGACGGAATCCGTCTTCCAGATCAGCAA...

Protein

Download Protein FASTA

1832 aa · LXL04_015268|LXL04_015268|OH1004|PROTEIN

MRVRVLEEDRDIDRIIITTTRTDLVDTRARSTDVERGIAGLPGQTDATNTLALLAEGRSPHDFAGTGSVIELTCWFEKTESVFQISNCTADCQVKLAACTFMHAALSWWNTHVQTIGIVEANALTWGDLRTMMIEEYCPRSKHQEFEQELWNLAMQGSDITGYTNRFDDLSVLCPGMVTPIVKKVERCIWGLSAQIQNSATAFNPLTYESVKSVVIRMTDQAVRQGIMVPKAEPSREQHKRKPWNSNSNSNNSNNNNRQI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015268`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015268

Location Chr03:67283842-67297797 (-)

Description Similar to POLD1: DNA polymerase delta catalytic subunit

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g63960`	This polymerase possesses two enzymatic activities: DNA synthesis (polymerase) and an exonucleolytic activity that degrades single-stranded DNA in the 3'- to 5'-direction.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os11g0186400`	This polymerase possesses two enzymatic activities: DNA synthesis (polymerase) and an exonucleolytic activity that degrades single-stranded DNA in the 3'- to 5'-direction.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015268 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006259 DNA metabolic process Biological Process

GO:0006260 DNA replication Biological Process

GO:0006261 DNA-templated DNA replication Biological Process

GO:0006278 RNA-templated DNA biosynthetic process Biological Process

GO:0006281 DNA repair Biological Process

GO:0006287 base-excision repair, gap-filling Biological Process

GO:0006297 nucleotide-excision repair, DNA gap filling Biological Process

GO:0006303 double-strand break repair via nonhomologous end joining Biological Process

GO:0043137 DNA replication, removal of RNA primer Biological Process

GO:0045004 DNA replication proofreading Biological Process

GO:0045005 DNA-templated DNA replication maintenance of fidelity Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT5G63960

ddi:DDB_G0285381

dosa:Os11g0186400

gmx:548092

sce:YDL102W

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.468

Rank 1 · LXL04_015268 · OH-1004

Nucleus0.412

Rank 2 · LXL04_015268 · OH-1004

Mitochondrion0.117

Rank 3 · LXL04_015268 · OH-1004

Cell membrane0.047

Rank 4 · LXL04_015268 · OH-1004

Endoplasmic reticulum0.040

Rank 5 · LXL04_015268 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03732.25PEG10_N-capsid61-137 aa

PF00078.33RVT_1413-511 aa

PF24626.2SH3_Tf2-1738-764 aa

PF03104.26DNA_pol_B_exo11050-1174 aa

PF22936.2Pol_BBD1212-1286 aa

PF13976.12gag_pre-integrs1344-1388 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015268	`PF03732.25`	PEG10_N-capsid	61	137	1.2e-06	29.4
LXL04_015268	`PF00078.33`	RVT_1	413	511	1.4e-19	71.5
LXL04_015268	`PF24626.2`	SH3_Tf2-1	738	764	4.1e-08	33.9
LXL04_015268	`PF03104.26`	DNA_pol_B_exo1	1050	1174	2.7e-28	99.7
LXL04_015268	`PF22936.2`	Pol_BBD	1212	1286	1.3e-08	35.7
LXL04_015268	`PF13976.12`	gag_pre-integrs	1344	1388	1.1e-08	35.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LVN7`	Arabidopsis thaliana	DNA polymerase delta catalytic subunit	69.930%	Swiss-Prot	weak database homology
`Q9LRE6`	Oryza sativa subsp. japonica	DNA polymerase delta catalytic subunit	76.923%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card