TkA06G251910 | RubberDandelionOmics

Gene overview

TkA06G251910

Reference: TK1151 Chr: Chr06 Coordinates: 64304743-64308232 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2744 bp · TkA06G251910|TK1151|cDNA

TTTTAACGGTTGCGGAGGCATTCCGCATTCGCCTGCTTTAAATTATAACCGGATCAACCCCTCAAAGAGTCTGGCGCGTACGGTGTACCCCACAATCGTGAGACCTTCACTCTGTTTTGGCTCTCTTTGGGGCTTCTCAACGGCTCAAGATTATAAAGTTTCACTTTTTTTTTTTGTGAAGTATCAAAAAATGAGACAAGAAACATACCGGCGGCCTTACGCTTCCGCCGTCTTAATCAAACGGCGAGTCTCTTAAAAAA...

CDS

Download CDS FASTA

1929 bp · TkA06G251910|TK1151|CDS

ATGGAAGTCGCAAACCATGTACAGTCATATTTGATCAGTAATTGCAAAGATTACGTAATAATGACTAGCGATATCAGAATATTTGTTGCTAAAATCGAATCATACTTGAACGATTTCATCAAGGCGTATGATTGGTTCCCATCAGATCCGATGAATCACCATAAACATTACGAGATTGGCATCCTGTGGGTTCTTTTGTTCCTTTCCCACAACATTGCGTCATTTAGTTGGTTTTTCAGTACCGGAAAGGTTGATTCCAG...

Protein

Download Protein FASTA

642 aa · TkA06G251910|TK1151|PROTEIN

MEVANHVQSYLISNCKDYVIMTSDIRIFVAKIESYLNDFIKAYDWFPSDPMNHHKHYEIGILWVLLFLSHNIASFSWFFSTGKVDSSENPSSHDIAAEFSMEPLNSKKGAALVEKAKRKAALSNSCWQNAYQNLFSGCSKILAGEEQRSRLAWHLSDCFQKDTGRPPFPYCDVSNPMVDCLKKLDKNDHKIYLEFYLETNSICHQLQTDAFKRQTERLVNDLKTSAEYAEEKLENIENHTEQLLHTSNHIQESLSSINGE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G251910`
TK1151 ID	TkA06G251910
OH-1004 ID	LXL04_023532
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G251910

Location Chr06:64304743-64308232 (+)

Description Similar to GEX1: Protein GAMETE EXPRESSED 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g55490`	Has a dual function during gametophyte development and early embryogenesis.	Arabidopsis thaliana GEX1 has dual functions in gametophyte development and early embryogenesis.2011 · DOI: 10.1111/j.1365-313x.2011.04713.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023532 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009553 embryo sac development Biological Process

GO:0009555 pollen development Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0042802 identical protein binding Molecular Function

KEGG gene cross-reference

ath:AT5G55490

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.360

Rank 1 · TkA06G251910 · TK1151

Golgi apparatus0.285

Rank 2 · TkA06G251910 · TK1151

Cytoplasm0.180

Rank 3 · TkA06G251910 · TK1151

Cell membrane0.159

Rank 4 · TkA06G251910 · TK1151

Lysosome / Vacuole0.141

Rank 5 · TkA06G251910 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26039Dcst2211-278 aa

PF06103DUF948214-273 aa

PF26039Dcst2314-379 aa

PF06103DUF948321-368 aa

PF06103DUF948341-393 aa

PF04080Per1454-555 aa

PF06686SpoIIIAC507-554 aa

PF19416Astro_VPg561-612 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G251910	`PF26039`	Dcst2	211	278	0.42	10.4
TkA06G251910	`PF06103`	DUF948	214	273	0.011	16.6
TkA06G251910	`PF26039`	Dcst2	314	379	0.42	10.4
TkA06G251910	`PF06103`	DUF948	321	368	0.011	16.6
TkA06G251910	`PF06103`	DUF948	341	393	0.011	16.6
TkA06G251910	`PF04080`	Per1	454	555	0.53	10.7
TkA06G251910	`PF06686`	SpoIIIAC	507	554	0.61	11.0
TkA06G251910	`PF19416`	Astro_VPg	561	612	4.1	9.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q681K7`	Arabidopsis thaliana	sp\|Q681K7\|GEX1_ARATH Protein GAMETE EXPRESSED 1	45.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card