TkA06G209700 | RubberDandelionOmics

Gene overview

TkA06G209700

Reference: TK1151 Chr: Chr06 Coordinates: 54367600-54368373 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

729 bp · TkA06G209700|TK1151|cDNA

ATTGAGTATGCAAAAAACGGATCGTTAAAAGACTGGATTCATGGTGGTTTAGCAATAAAAAGCCATTTCATTGCTTCATGTTCTTGTTTGCTGACATGGAACCAAAGGCTAAAGATTTGCTTGAATATAGCCACGGCATTACAATTCATGCATCAGATAATTAACCCAAGTTATGTCCATCGAAACATCAAGAGTCGGAATATTTTTCTTGATGAAGAATTTCATGCCAAAGTTGGTAACTTTGGCATGGATGAATATAT...

CDS

Download CDS FASTA

729 bp · TkA06G209700|TK1151|CDS

ATTGAGTATGCAAAAAACGGATCGTTAAAAGACTGGATTCATGGTGGTTTAGCAATAAAAAGCCATTTCATTGCTTCATGTTCTTGTTTGCTGACATGGAACCAAAGGCTAAAGATTTGCTTGAATATAGCCACGGCATTACAATTCATGCATCAGATAATTAACCCAAGTTATGTCCATCGAAACATCAAGAGTCGGAATATTTTTCTTGATGAAGAATTTCATGCCAAAGTTGGTAACTTTGGCATGGATGAATATAT...

Protein

Download Protein FASTA

242 aa · TkA06G209700|TK1151|PROTEIN

IEYAKNGSLKDWIHGGLAIKSHFIASCSCLLTWNQRLKICLNIATALQFMHQIINPSYVHRNIKSRNIFLDEEFHAKVGNFGMDEYMCSTYPMTWDKGYMAPEYSDSGVGTPSTDIYAYGVVILEILSGKPPIMKSKSEGSEDNSRLSETIKVILESGNSEKMREWMDDALGDNYSFDAAMILANLARTCVDDDPSSRPDAGEIVVKLSELVTGEVEQVIVRESSCRPLVAQPFAIKDINDY

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G209700`
TK1151 ID	TkA06G209700
OH-1004 ID	LXL04_023837
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	93.400
Protein coverage (%)	TK1151 100.000 / OH-1004 57.238 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G209700

Location Chr06:54367600-54368373 (-)

Description Similar to LYK2: Protein LYK2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g01840`	May recognize microbe-derived N-acetylglucosamine (NAG)-containing ligands.	No verified direct reference in this release
`At2g33580`	May recognize microbe-derived N-acetylglucosamine (NAG)-containing ligands.	No verified direct reference in this release
`At1g51940`	Putative Lysin motif (LysM) receptor kinase that may recognize microbe-derived N-acetylglucosamine (NAG)-containing ligands.	No verified direct reference in this release
`At2g28250`	Receptor-like serine/threonine-protein kinase NCRK.	No verified direct reference in this release
`At3g17420`	Probable receptor-like protein kinase At3g17420.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023837 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002758 innate immune response-activating signaling pathway Biological Process

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process

GO:0010089 xylem development Biological Process

GO:0031348 negative regulation of defense response Biological Process

GO:0045087 innate immune response Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0071323 cellular response to chitin Biological Process

GO:0005576 extracellular region Cellular Component

KEGG gene cross-reference

ath:AT1G51940

ath:AT2G28250

ath:AT2G33580

ath:AT3G01840

dosa:Os08g0538300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.524

Rank 1 · TkA06G209700 · TK1151

Cytoplasm0.351

Rank 2 · TkA06G209700 · TK1151

Nucleus0.291

Rank 3 · TkA06G209700 · TK1151

Endoplasmic reticulum0.041

Rank 4 · TkA06G209700 · TK1151

Golgi apparatus0.033

Rank 5 · TkA06G209700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase2-205 aa

PF07714PK_Tyr_Ser-Thr2-208 aa

PF25399DeaD_dimer43-52 aa

PF14531Kinase-like57-143 aa

PF25399DeaD_dimer146-197 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G209700	`PF00069`	Pkinase	2	205	5.8e-22	79.1
TkA06G209700	`PF07714`	PK_Tyr_Ser-Thr	2	208	1.7e-21	77.4
TkA06G209700	`PF25399`	DeaD_dimer	43	52	0.066	14.0
TkA06G209700	`PF14531`	Kinase-like	57	143	0.00037	20.6
TkA06G209700	`PF25399`	DeaD_dimer	146	197	0.066	14.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SGI7`	Arabidopsis thaliana	sp\|Q9SGI7\|LYK2_ARATH Protein LYK2	41.500%	Swiss-Prot	Medium
`O22808`	Arabidopsis thaliana	sp\|O22808\|LYK5_ARATH Protein LYK5	37.200%	Swiss-Prot	Medium
`F4IB81`	Arabidopsis thaliana	sp\|F4IB81\|LYK3_ARATH LysM domain receptor-like kinase 3	33.200%	Swiss-Prot	Medium
`Q8VYY5`	Arabidopsis thaliana	sp\|Q8VYY5\|NCRK_ARATH Receptor-like serine/threonine-protein kinase NCRK	32.200%	Swiss-Prot	Medium
`Q9LRP3`	Arabidopsis thaliana	sp\|Q9LRP3\|Y3174_ARATH Probable receptor-like protein kinase At3g17420	32.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card