TkA06G146850 | RubberDandelionOmics

Gene overview

TkA06G146850

Reference: TK1151 Chr: Chr06 Coordinates: 38486661-38490973 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1814 bp · TkA06G146850|TK1151|cDNA

CACAAGCGCTTAAAATGTAGCGAGTTACTGCAAACAGCTTTTATATATATAGTTGGTGGGATTACACAATCCCTTCGTTTTCAAACACTTAATCATATACGCCATGTGAAGTACTCGAAGAATCCTCCACAGTTCAAGAAATTAACCATTTGGGATGAGACTTCATACGAAATACTATATGTAAGCAAACACCACGAAATTAGGAGAAAGCTGCTTAACAAAATATGGACATGGGGTACGGAGCTTACGTTGATACGCAA...

CDS

Download CDS FASTA

1395 bp · TkA06G146850|TK1151|CDS

ATGGACATGGGGTACGGAGCTTACGTTGATACGCAACTTGAATCGCTCGTTGATAGAATCCATCCTCCAAGGGTTTGCATCGACAATGATTCGTATTCAGATTGCACCCTTGTGAAGGTTGATAGTACGAACAAGCCTGGGGTGTTGTTGGAGATGGTGCAAGAGCTAACGGATCTTGGCCTTGTCATCTCCAAATCGTACATTTGTTCCGATGGTCCCTGGTTCATGGATGTATTCCACGTGTCCGATCAATCTAGCAA...

Protein

Download Protein FASTA

464 aa · TkA06G146850|TK1151|PROTEIN

MDMGYGAYVDTQLESLVDRIHPPRVCIDNDSYSDCTLVKVDSTNKPGVLLEMVQELTDLGLVISKSYICSDGPWFMDVFHVSDQSSNKITDKNLIRHIQQSICASRREKTEVKPTSLGKEIRLRNLPTDHTTLEMTMVDKPGMLSEISAVLAELKCHVSAAVAWTHNNRAACIIHVQDDLKSGPIMDPHRVNRVQAYLSTVVNAHHNNNEHRSLRLTSPTTGQTHTERRLHQLMMADKDYEETSYASSSIKHYDTVVTVE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G146850`
TK1151 ID	TkA06G146850
OH-1004 ID	LXL04_025740
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	48.100
Protein coverage (%)	TK1151 86.853 / OH-1004 86.147 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G146850

Location Chr06:38486661-38490973 (+)

Description Similar to ACR4: ACT domain-containing protein ACR4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g65890`	May bind amino acids.	No verified direct reference in this release
`At1g76990`	May bind amino acids.	Molecular characterization of a novel gene family encoding ACT domain repeat proteins in Arabidopsis.2002 · DOI: 10.1104/pp.007484
`At5g25320`	May bind amino acids.	No verified direct reference in this release
`At1g69040`	May bind amino acids.	No verified direct reference in this release
`At1g12420`	May bind amino acids.	Molecular characterization of a novel gene family encoding ACT domain repeat proteins in Arabidopsis.2002 · DOI: 10.1104/pp.007484

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025740 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006521 regulation of amino acid metabolic process Biological Process

GO:0009735 response to cytokinin Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016597 amino acid binding Molecular Function

KEGG gene cross-reference

ath:AT1G12420

ath:AT1G69040

ath:AT1G76990

ath:AT2G03730

ath:AT3G01990

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.491

Rank 1 · TkA06G146850 · TK1151

Nucleus0.415

Rank 2 · TkA06G146850 · TK1151

Cell membrane0.135

Rank 3 · TkA06G146850 · TK1151

Lysosome / Vacuole0.060

Rank 4 · TkA06G146850 · TK1151

Endoplasmic reticulum0.040

Rank 5 · TkA06G146850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24931ACT_ACR9_3rd25-99 aa

PF26956ACT_ACR_D132-108 aa

PF24914ACR10_N32-103 aa

PF13840ACT_733-60 aa

PF22754bHLH-TF_ACT-like_plant36-101 aa

PF01842ACT37-87 aa

PF13291ACT_438-65 aa

PF22629ACT_AHAS_ss40-52 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G146850	`PF24931`	ACT_ACR9_3rd	25	99	1.4e-16	61.0
TkA06G146850	`PF26956`	ACT_ACR_D1	32	108	1.4e-52	176.2
TkA06G146850	`PF24914`	ACR10_N	32	103	1.9e-11	44.0
TkA06G146850	`PF13840`	ACT_7	33	60	0.087	13.4
TkA06G146850	`PF22754`	bHLH-TF_ACT-like_plant	36	101	1e-12	48.7
TkA06G146850	`PF01842`	ACT	37	87	2.7e-33	114.0
TkA06G146850	`PF13291`	ACT_4	38	65	3.7e-12	47.4
TkA06G146850	`PF22629`	ACT_AHAS_ss	40	52	4.8e-08	33.8
TkA06G146850	`PF24926`	ACT_ACR9_C	43	83	0.0002	21.9
TkA06G146850	`PF13740`	ACT_6	43	57	0.00077	20.0
TkA06G146850	`PF24931`	ACT_ACR9_3rd	127	195	1.4e-16	61.0
TkA06G146850	`PF24914`	ACR10_N	129	168	1.9e-11	44.0
TkA06G146850	`PF01842`	ACT	131	167	2.7e-33	114.0
TkA06G146850	`PF22754`	bHLH-TF_ACT-like_plant	131	167	1e-12	48.7
TkA06G146850	`PF13291`	ACT_4	131	176	3.7e-12	47.4
TkA06G146850	`PF26956`	ACT_ACR_D1	132	179	1.4e-52	176.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FHP1`	Arabidopsis thaliana	sp\|Q9FHP1\|ACR1_ARATH ACT domain-containing protein ACR1	48.600%	Swiss-Prot	Medium
`O49285`	Arabidopsis thaliana	sp\|O49285\|ACR3_ARATH ACT domain-containing protein ACR3	50.200%	Swiss-Prot	High
`F4JWR0`	Arabidopsis thaliana	sp\|F4JWR0\|ACR2_ARATH ACT domain-containing protein ACR2	43.100%	Swiss-Prot	Medium
`Q8LJW3`	Arabidopsis thaliana	sp\|Q8LJW3\|ACR4_ARATH ACT domain-containing protein ACR4	44.200%	Swiss-Prot	Medium
`Q9LNA5`	Arabidopsis thaliana	sp\|Q9LNA5\|ACR8_ARATH ACT domain-containing protein ACR8	45.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card