TkA06G115030 | RubberDandelionOmics

Gene overview

TkA06G115030

Reference: TK1151 Chr: Chr06 Coordinates: 30102890-30106030 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1297 bp · TkA06G115030|TK1151|cDNA

GCCGATTAGGCTAAAATACGCACATGCCCCCACATCACCACAGCCAGAGCCAATACGTCTTTGTCTTTATTGTCCGCCATTTTCTTTTTCTTCACTTTTCCTCCATACTTTAATCTCAACTTCTACACCACTGCTGCTGACTCTCTGTTCCAATCACTTGACTTCTAGAGAGAGAGAGCCAATTTTGCATTGGGTAATGGTGAAATCTGAGAGCTGAAAACACAGCAAGGAATCATGGAACAGGATGAAGGGAACAATAA...

CDS

Download CDS FASTA

783 bp · TkA06G115030|TK1151|CDS

ATGGAACAGGATGAAGGGAACAATAATACTAATGGAGGGATGTTTGTCAAAGTAATGACTGATGAACAAATGGAAGTTCTTCGCAAACAAATCGCGATTTATGCTACTATTTGCGAACAGCTTGTCGATTTGCATAAATCGCTTACTTCTCATCACGATCTAGGAGGAGTCAGACTTGGAAACTTATACAGCGACCCATTAGTCACATCCGGCGGCCACAAATTTTCCGGCAGACAACGGTGGACACCAACACCGGTTCA...

Protein

Download Protein FASTA

260 aa · TkA06G115030|TK1151|PROTEIN

MEQDEGNNNTNGGMFVKVMTDEQMEVLRKQIAIYATICEQLVDLHKSLTSHHDLGGVRLGNLYSDPLVTSGGHKFSGRQRWTPTPVQLQILERLFEQGNGTPSKQKIKEITSELSQHGQISETNVYNWFQNRRARSKRKQQVSSAPNNGESEVETEVESPKPQQNSASTADDNMCFQNPNVSSGISSVDQRAKKVEPVFPSDATSKAAGNNLGQMSYYGSMLANPNCTSVNAGMDCIIGKMEAQGSYQSYMQGDEYNMPG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G115030`
TK1151 ID	TkA06G115030
OH-1004 ID	LXL04_024723
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G115030

Location Chr06:30102890-30106030 (-)

Description Similar to WOX8: WUSCHEL-related homeobox 8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35550`	Transcription factor involved in the regulation of fruit patterning.	The WOX13 homeobox gene promotes replum formation in the Arabidopsis thaliana fruit.2013 · DOI: 10.1111/tpj.12010 Wound-inducible WUSCHEL-RELATED HOMEOBOX 13 is required for callus growth and organ reconnection.2022 · DOI: 10.1093/plphys/kiab510
`At1g20700`	Acts redundantly with WOX4 downstream of the TDR/PXY receptor kinase to regulate procambial cell proliferation and differentiation in vascular tissue, independently of any role in vascular.	WOX14 promotes bioactive gibberellin synthesis and vascular cell differentiation in Arabidopsis.2017 · DOI: 10.1111/tpj.13513
`At1g20710`	Potential transcription factor that plays a central role during developmental processes.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0818400`	Transcription factor which may be involved in developmental processes.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024723 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0010047 fruit dehiscence Biological Process

GO:0010072 primary shoot apical meristem specification Biological Process

GO:0010087 phloem or xylem histogenesis Biological Process

GO:0051301 cell division Biological Process

GO:0099402 plant organ development Biological Process

GO:1990058 fruit replum development Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT1G20700

ath:AT1G20710

ath:AT3G18010

ath:AT4G35550

dosa:Os01g0818400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.984

Rank 1 · TkA06G115030 · TK1151

Cytoplasm0.084

Rank 2 · TkA06G115030 · TK1151

Cell membrane0.018

Rank 3 · TkA06G115030 · TK1151

Endoplasmic reticulum0.011

Rank 4 · TkA06G115030 · TK1151

Plastid0.007

Rank 5 · TkA06G115030 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00046Homeodomain19-29 aa

PF24426HTH_NDX19-31 aa

PF08880QLQ19-34 aa

PF00046Homeodomain78-138 aa

PF08880QLQ84-92 aa

PF24426HTH_NDX104-141 aa

PF05920Homeobox_KN111-135 aa

PF27880Sec_Non_Glob120-196 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G115030	`PF00046`	Homeodomain	19	29	4.2e-17	62.4
TkA06G115030	`PF24426`	HTH_NDX	19	31	0.0038	17.9
TkA06G115030	`PF08880`	QLQ	19	34	0.052	13.9
TkA06G115030	`PF00046`	Homeodomain	78	138	4.2e-17	62.4
TkA06G115030	`PF08880`	QLQ	84	92	0.052	13.9
TkA06G115030	`PF24426`	HTH_NDX	104	141	0.0038	17.9
TkA06G115030	`PF05920`	Homeobox_KN	111	135	0.0096	16.5
TkA06G115030	`PF27880`	Sec_Non_Glob	120	196	0.45	11.2
TkA06G115030	`PF24426`	HTH_NDX	158	182	0.0038	17.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81788`	Arabidopsis thaliana	sp\|O81788\|WOX13_ARATH WUSCHEL-related homeobox 13	71.000%	Swiss-Prot	Medium
`Q9LM84`	Arabidopsis thaliana	sp\|Q9LM84\|WOX14_ARATH WUSCHEL-related homeobox 14	57.000%	Swiss-Prot	Medium
`Q9LM83`	Arabidopsis thaliana	sp\|Q9LM83\|WOX10_ARATH Putative WUSCHEL-related homeobox 10	61.100%	Swiss-Prot	Low
`Q5QMM3`	Oryza sativa subsp. japonica	sp\|Q5QMM3\|WOX8_ORYSJ WUSCHEL-related homeobox 8	53.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card