LXL04_024723 | RubberDandelionOmics

Gene overview

LXL04_024723

Reference: OH-1004 Chr: Chr05 Coordinates: 97445597-97448236 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

786 bp · LXL04_024723|LXL04_024723|OH1004|cDNA

ATGGAACAGGATGAAGGGAACAATAATACCAATGGAGGGATGTTTGTCAAAGTAATGACTGATGAACAAATGGAAGTTCTTCGCAAACAAATCGCGATTTATGCTACTATTTGCGAACAGCTTGTCGATTTGCATAAATCGCTTACTTCTCATCACGATCTAGGAGGAGTCAGACTTGGAAACTTATACAGCGACCCATTAGTCACATCCGGCGGCCACAAATTTTCCGGCAGACAACGGTGGACACCAACACCGGTTCA...

CDS

Download CDS FASTA

786 bp · LXL04_024723|LXL04_024723|OH1004|CDS

ATGGAACAGGATGAAGGGAACAATAATACCAATGGAGGGATGTTTGTCAAAGTAATGACTGATGAACAAATGGAAGTTCTTCGCAAACAAATCGCGATTTATGCTACTATTTGCGAACAGCTTGTCGATTTGCATAAATCGCTTACTTCTCATCACGATCTAGGAGGAGTCAGACTTGGAAACTTATACAGCGACCCATTAGTCACATCCGGCGGCCACAAATTTTCCGGCAGACAACGGTGGACACCAACACCGGTTCA...

Protein

Download Protein FASTA

261 aa · LXL04_024723|LXL04_024723|OH1004|PROTEIN

MEQDEGNNNTNGGMFVKVMTDEQMEVLRKQIAIYATICEQLVDLHKSLTSHHDLGGVRLGNLYSDPLVTSGGHKFSGRQRWTPTPVQLQILERLFEQGNGTPSKQKIKEITSELSQHGQISETNVYNWFQNRRARSKRKQQVSSAPNNGESEVETEVESPKPQQNSASTADDNMCFQNPNVSSGISSVDQRAKKVEPVFPSDATSKAAGNNLGQMSYYGSMLANPTDCTSVNAGMDCIIGKMEAQGSYQSYMQGDEYNMP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_024723`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_024723

Location Chr05:97445597-97448236 (+)

Description Similar to WOX8: WUSCHEL-related homeobox 8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g35550`	Transcription factor involved in the regulation of fruit patterning.	The WOX13 homeobox gene promotes replum formation in the Arabidopsis thaliana fruit.2013 · DOI: 10.1111/tpj.12010 Wound-inducible WUSCHEL-RELATED HOMEOBOX 13 is required for callus growth and organ reconnection.2022 · DOI: 10.1093/plphys/kiab510
`At1g20700`	Acts redundantly with WOX4 downstream of the TDR/PXY receptor kinase to regulate procambial cell proliferation and differentiation in vascular tissue, independently of any role in vascular.	WOX14 promotes bioactive gibberellin synthesis and vascular cell differentiation in Arabidopsis.2017 · DOI: 10.1111/tpj.13513
`At1g20710`	Potential transcription factor that plays a central role during developmental processes.	No verified direct reference in this release
`At3g18010`	Transcription factor which may be involved in developmental processes.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0818400`	Transcription factor which may be involved in developmental processes.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024723 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0010047 fruit dehiscence Biological Process

GO:0010072 primary shoot apical meristem specification Biological Process

GO:0010087 phloem or xylem histogenesis Biological Process

GO:0051301 cell division Biological Process

GO:0099402 plant organ development Biological Process

GO:1990058 fruit replum development Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT1G20700

ath:AT1G20710

ath:AT3G18010

ath:AT4G35550

dosa:Os01g0818400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.983

Rank 1 · LXL04_024723 · OH-1004

Cytoplasm0.085

Rank 2 · LXL04_024723 · OH-1004

Cell membrane0.018

Rank 3 · LXL04_024723 · OH-1004

Endoplasmic reticulum0.011

Rank 4 · LXL04_024723 · OH-1004

Plastid0.007

Rank 5 · LXL04_024723 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00046.36Homeodomain78-138 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_024723	`PF00046.36`	Homeodomain	78	138	4.2e-17	62.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81788`	Arabidopsis thaliana	WUSCHEL-related homeobox 13	46.909%	Swiss-Prot	moderate database homology
`Q9LM84`	Arabidopsis thaliana	WUSCHEL-related homeobox 14	50.857%	Swiss-Prot	moderate database homology
`Q9LM83`	Arabidopsis thaliana	Putative WUSCHEL-related homeobox 10	44.828%	Swiss-Prot	moderate database homology
`Q6X7K0`	Arabidopsis thaliana	WUSCHEL-related homeobox 1	48.387%	Swiss-Prot	weak database homology
`Q5QMM3`	Oryza sativa subsp. japonica	WUSCHEL-related homeobox 8	51.394%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card