TkA06G095180 | RubberDandelionOmics

Gene overview

TkA06G095180

Reference: TK1151 Chr: Chr06 Coordinates: 25310623-25314631 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3286 bp · TkA06G095180|TK1151|cDNA

ACGTTACCGAGGTCGTTGAAGAATTATTCAAAGTTTGCTATGAATTATTAATTATTCAAAATAACGGTGGTTTTGATTAGTCGACGGCGACGCTGACATTTTTAGCGTGTGCATGTCGCAATCATCCATCGTCTCTGCTCACTTTGAAGTTTATTACAAGCAAAAGTGCAAAACACCCAAATTTCTCATTACTAGAAACAAAATCAAGAATAGCCTAATTAAAACAGTAATCAACTTTTTACCTTGGACACTTGTAGCGC...

CDS

Download CDS FASTA

2160 bp · TkA06G095180|TK1151|CDS

ATGGCAAGCATTTCACCGTCGCCAAACTCTCCACCAGTCACCGTTCCTCCATTGTCGCCCCCGCCGTTGATTCCTGCAGCTCCTAACTCTAGTCCACCTTCTGATTCCTCCCCACCATCTCAATCGGCTCCTCCGCTACCAACCACTCAATCCCCACCCCCTTCAATGTCAGCCACTCCTCCATCATCACCTCCAACGACGTCACCTCCTCCACCACCTACCGCCCCACCTCCGTCAACACCGCCCGTATCTTCACCTCC...

Protein

Download Protein FASTA

719 aa · TkA06G095180|TK1151|PROTEIN

MASISPSPNSPPVTVPPLSPPPLIPAAPNSSPPSDSSPPSQSAPPLPTTQSPPPSMSATPPSSPPTTSPPPPPTAPPPSTPPVSSPPPVSTSPPTNPPPPSSPTPPTNSTPPATSPPPPTASPPPPATSPPPLSTSPPPIRSPPPATSPPQTRSPPPSSPSPPARSPPPRTPSTRSPPPPSPPTTSPPLPSSTPPPTSPPPSSSTPPQPPPRSTTSPPPRTPPSSTPPTNSPPPPLTTSPPLTTPSPPPSRPSPSPSPPS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G095180`
TK1151 ID	TkA06G095180
OH-1004 ID	LXL04_024931
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.400
Protein coverage (%)	TK1151 45.897 / OH-1004 95.376 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G095180

Location Chr06:25310623-25314631 (-)

Description Similar to PERK9: Proline-rich receptor-like protein kinase PERK9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68690`	Could be involved in the negative regulation of root growth.	No verified direct reference in this release
`At1g26150`	Could be involved in the negative regulation of root growth.	No verified direct reference in this release
`At5g38560`	Could be involved in the negative regulation of root growth.	PERK-KIPK-KCBP signalling negatively regulates root growth in Arabidopsis thaliana.2015 · DOI: 10.1093/jxb/eru390
`At1g70460`	Negatively regulates root hair elongation.	No verified direct reference in this release
`At1g23540`	Regulates the auxin-related MAX (More Axillary Growth) pathway during the shoot branching.	Over-expression of the IGI1 leading to altered shoot-branching development related to MAX pathway in Arabidopsis.2010 · DOI: 10.1007/s11103-010-9645-0

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024931 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0007165 signal transduction Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0032502 developmental process Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:1990641 response to iron ion starvation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0090406 pollen tube Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G23540

ath:AT1G26150

ath:AT1G68690

ath:AT1G70460

ath:AT5G38560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.855

Rank 1 · TkA06G095180 · TK1151

Nucleus0.092

Rank 2 · TkA06G095180 · TK1151

Cytoplasm0.090

Rank 3 · TkA06G095180 · TK1151

Endoplasmic reticulum0.059

Rank 4 · TkA06G095180 · TK1151

Plastid0.017

Rank 5 · TkA06G095180 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29364TED6301-322 aa

PF00069Pkinase389-591 aa

PF07714PK_Tyr_Ser-Thr390-658 aa

PF03109ABC1394-416 aa

PF03109ABC1497-534 aa

PF01636APH498-534 aa

PF17667Pkinase_fungal505-578 aa

PF01410COLFI613-659 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G095180	`PF29364`	TED6	301	322	0.088	13.4
TkA06G095180	`PF00069`	Pkinase	389	591	1.7e-43	149.6
TkA06G095180	`PF07714`	PK_Tyr_Ser-Thr	390	658	9.9e-46	156.8
TkA06G095180	`PF03109`	ABC1	394	416	0.0021	18.0
TkA06G095180	`PF03109`	ABC1	497	534	0.0021	18.0
TkA06G095180	`PF01636`	APH	498	534	0.24	11.9
TkA06G095180	`PF17667`	Pkinase_fungal	505	578	0.014	14.9
TkA06G095180	`PF01410`	COLFI	613	659	0.39	10.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SX31`	Arabidopsis thaliana	sp\|Q9SX31\|PERK9_ARATH Proline-rich receptor-like protein kinase PERK9	69.400%	Swiss-Prot	Medium
`Q9C660`	Arabidopsis thaliana	sp\|Q9C660\|PEK10_ARATH Proline-rich receptor-like protein kinase PERK10	68.500%	Swiss-Prot	Medium
`Q9FFW5`	Arabidopsis thaliana	sp\|Q9FFW5\|PERK8_ARATH Proline-rich receptor-like protein kinase PERK8	62.400%	Swiss-Prot	Medium
`Q9CAL8`	Arabidopsis thaliana	sp\|Q9CAL8\|PEK13_ARATH Proline-rich receptor-like protein kinase PERK13	63.500%	Swiss-Prot	Medium
`Q9ZUE0`	Arabidopsis thaliana	sp\|Q9ZUE0\|PEK12_ARATH Proline-rich receptor-like protein kinase PERK12	63.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card