TkA06G058380 | RubberDandelionOmics

Gene overview

TkA06G058380

Reference: TK1151 Chr: Chr06 Coordinates: 15800966-15803722 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2683 bp · TkA06G058380|TK1151|cDNA

CTGCATATCATACAATACCAATTGTCATCTCTTTTTCTCTCCATCCATCTATATATCTCACTCTACAAATTCGTACAAATCATGTATCTATATATCCTATGTTTCTCTCTATCCATAACTCTCTCATATGGAGCCAACACCATATCTGCAAACCAGTCTTTGTCTGGAGACCAAACGATCATATCAGAAAGAGAAGAGTTCGAGCTCGGGTTCTTCAAAGCTGGTGACTCCTCAAACTATTACATTGGCATCTGGTATAA...

CDS

Download CDS FASTA

1701 bp · TkA06G058380|TK1151|CDS

ATGTATCTATATATCCTATGTTTCTCTCTATCCATAACTCTCTCATATGGAGCCAACACCATATCTGCAAACCAGTCTTTGTCTGGAGACCAAACGATCATATCAGAAAGAGAAGAGTTCGAGCTCGGGTTCTTCAAAGCTGGTGACTCCTCAAACTATTACATTGGCATCTGGTATAAAAAACGCTCTTCCAATCCTCCTACCATTGTTTGGGTGGCAAATAGAGAAACACCCATCTCTGATAGATTCCGTTCAGAATT...

Protein

Download Protein FASTA

566 aa · TkA06G058380|TK1151|PROTEIN

MYLYILCFSLSITLSYGANTISANQSLSGDQTIISEREEFELGFFKAGDSSNYYIGIWYKKRSSNPPTIVWVANRETPISDRFRSELKIIDGNLVLLNESKSRIWSTNVTTTTTFNSVVAVILDNGNLVLRDGSNSDVSVWQSFDHPTHTWLPGAKLAYNNRTKKSQPLTSWKSKEDPGVGLFSLELHPIPKEYVIEWNGSQQYWTSGSWNGKSFDLVPEMRMEFIYNFSYHTDENESYIAYPVYDDPSFISRLVMDVSG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G058380`
TK1151 ID	TkA06G058380
OH-1004 ID	LXL04_025450
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.800
Protein coverage (%)	TK1151 96.290 / OH-1004 32.950 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G058380

Location Chr06:15800966-15803722 (-)

Description Similar to At2g19130: G-type lectin S-receptor-like serine/threonine-protein kinase At2g19130

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g19130`	G-type lectin S-receptor-like serine/threonine-protein kinase At2g19130.	No verified direct reference in this release
`At4g21380`	Involved in the regulation of cellular expansion and differentiation.	No verified direct reference in this release
`At4g11900`	G-type lectin S-receptor-like serine/threonine-protein kinase At4g11900.	No verified direct reference in this release
`UniProt: P0DH86`	Female specificity determinant of self-incompatibility.	No verified direct reference in this release
`At4g27290`	G-type lectin S-receptor-like serine/threonine-protein kinase At4g27290.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025450 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0006955 immune response Biological Process

GO:0007165 signal transduction Biological Process

GO:0048544 recognition of pollen Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT2G19130

ath:AT4G00340

ath:AT4G21380

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.759

Rank 1 · TkA06G058380 · TK1151

Extracellular0.088

Rank 2 · TkA06G058380 · TK1151

Endoplasmic reticulum0.082

Rank 3 · TkA06G058380 · TK1151

Cytoplasm0.068

Rank 4 · TkA06G058380 · TK1151

Lysosome / Vacuole0.034

Rank 5 · TkA06G058380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01453B_lectin68-173 aa

PF00954S_locus_glycop205-314 aa

PF08277PAN_3282-289 aa

PF08276PAN_2293-307 aa

PF08276PAN_2341-397 aa

PF00024PAN_1356-397 aa

PF08277PAN_3356-407 aa

PF00954S_locus_glycop362-379 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G058380	`PF01453`	B_lectin	68	173	2.8e-34	118.4
TkA06G058380	`PF00954`	S_locus_glycop	205	314	4.3e-32	111.6
TkA06G058380	`PF08277`	PAN_3	282	289	0.0026	18.3
TkA06G058380	`PF08276`	PAN_2	293	307	4.3e-10	40.3
TkA06G058380	`PF08276`	PAN_2	341	397	4.3e-10	40.3
TkA06G058380	`PF00024`	PAN_1	356	397	0.00092	19.7
TkA06G058380	`PF08277`	PAN_3	356	407	0.0026	18.3
TkA06G058380	`PF00954`	S_locus_glycop	362	379	4.3e-32	111.6
TkA06G058380	`PF28574`	Transporter_N	417	443	0.16	12.7
TkA06G058380	`PF21314`	TM_ErbB1	430	462	0.098	13.1
TkA06G058380	`PF07714`	PK_Tyr_Ser-Thr	482	545	8.2e-09	35.9
TkA06G058380	`PF00069`	Pkinase	483	544	1.2e-07	32.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64477`	Arabidopsis thaliana	sp\|O64477\|Y2913_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At2g19130	49.400%	Swiss-Prot	Medium
`O81905`	Arabidopsis thaliana	sp\|O81905\|SD18_ARATH Receptor-like serine/threonine-protein kinase SD1-8	37.800%	Swiss-Prot	Medium
`Q9T058`	Arabidopsis thaliana	sp\|Q9T058\|Y4119_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At4g11900	38.400%	Swiss-Prot	Medium
`P0DH86`	Arabidopsis thaliana	sp\|P0DH86\|SRK_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase SRK	37.000%	Swiss-Prot	Medium
`O81832`	Arabidopsis thaliana	sp\|O81832\|Y4729_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At4g27290	32.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card