LXL04_025450 | RubberDandelionOmics

Gene overview

LXL04_025450

Reference: OH-1004 Chr: Chr05 Coordinates: 111959949-111968964 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4965 bp · LXL04_025450|LXL04_025450|OH1004|cDNA

ATGTATCTATATATCCTATGTTTCTCTCTATCCATAACTCTCTCATATGGAGCCAACACCATATCTGCAAACCAGTCTTTGTCTGGAGACCAAACGATCATATCAGAAAGAGAAGAGTTCGAGCTCGGGTTCTTCAAAGCTGGTGACTCCTCAAACTATTACATTGGCATCTGGTATAAAAAACGCTCTTCCAATCCTCCTACCATTGTTTGGGTGGCAAATAGAGAAACACCCATCTCTGATAGATGCCGTTCAGAATT...

CDS

Download CDS FASTA

4965 bp · LXL04_025450|LXL04_025450|OH1004|CDS

ATGTATCTATATATCCTATGTTTCTCTCTATCCATAACTCTCTCATATGGAGCCAACACCATATCTGCAAACCAGTCTTTGTCTGGAGACCAAACGATCATATCAGAAAGAGAAGAGTTCGAGCTCGGGTTCTTCAAAGCTGGTGACTCCTCAAACTATTACATTGGCATCTGGTATAAAAAACGCTCTTCCAATCCTCCTACCATTGTTTGGGTGGCAAATAGAGAAACACCCATCTCTGATAGATGCCGTTCAGAATT...

Protein

Download Protein FASTA

1654 aa · LXL04_025450|LXL04_025450|OH1004|PROTEIN

MYLYILCFSLSITLSYGANTISANQSLSGDQTIISEREEFELGFFKAGDSSNYYIGIWYKKRSSNPPTIVWVANRETPISDRCRSELKIIDGNLVLLNESKSRIWSTNVTTTTTFNSVVAVILDNGNLVLRDGSNSDVSVWQSFDHPTHTWLPGAKLAYNNRTKKSQPLTSWKSKEDPGVGLFSLELHPIPKEYVIEWNGSQQYWTSGSWNGKSFDLVPEMRMEFIYNFSYHTDENESYIAYPVYDDPSFISRLVMDVSG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025450`
TK1151 ID	TkA06G058380
OH-1004 ID	LXL04_025450
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.800
Protein coverage (%)	TK1151 96.290 / OH-1004 32.950 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025450

Location Chr05:111959949-111968964 (+)

Description Similar to At2g19130: G-type lectin S-receptor-like serine/threonine-protein kinase At2g19130

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g19130`	G-type lectin S-receptor-like serine/threonine-protein kinase At2g19130.	No verified direct reference in this release
`At4g00340`	Serine/threonine-protein kinase.	No verified direct reference in this release
`At4g21380`	Involved in the regulation of cellular expansion and differentiation.	No verified direct reference in this release
`At4g11900`	G-type lectin S-receptor-like serine/threonine-protein kinase At4g11900.	No verified direct reference in this release
`At1g65790`	Involved in the regulation of cellular expansion and differentiation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025450 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0006955 immune response Biological Process

GO:0007165 signal transduction Biological Process

GO:0048544 recognition of pollen Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT2G19130

ath:AT4G00340

ath:AT4G21380

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.749

Rank 1 · LXL04_025450 · OH-1004

Cytoplasm0.096

Rank 2 · LXL04_025450 · OH-1004

Endoplasmic reticulum0.089

Rank 3 · LXL04_025450 · OH-1004

Extracellular0.060

Rank 4 · LXL04_025450 · OH-1004

Lysosome / Vacuole0.052

Rank 5 · LXL04_025450 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01453.31B_lectin68-173 aa

PF00954.26S_locus_glycop205-314 aa

PF08276.18PAN_2341-397 aa

PF07714.24PK_Tyr_Ser-Thr482-745 aa

PF00069.32Pkinase483-741 aa

PF01453.31B_lectin929-1031 aa

PF00954.26S_locus_glycop1063-1172 aa

PF08276.18PAN_21200-1251 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025450	`PF01453.31`	B_lectin	68	173	5.6e-66	220.3
LXL04_025450	`PF00954.26`	S_locus_glycop	205	314	5.9e-58	194.9
LXL04_025450	`PF08276.18`	PAN_2	341	397	2.3e-15	57.2
LXL04_025450	`PF07714.24`	PK_Tyr_Ser-Thr	482	745	3.6e-87	292.7
LXL04_025450	`PF00069.32`	Pkinase	483	741	4.9e-98	328.4
LXL04_025450	`PF01453.31`	B_lectin	929	1031	5.6e-66	220.3
LXL04_025450	`PF00954.26`	S_locus_glycop	1063	1172	5.9e-58	194.9
LXL04_025450	`PF08276.18`	PAN_2	1200	1251	2.3e-15	57.2
LXL04_025450	`PF07714.24`	PK_Tyr_Ser-Thr	1336	1600	3.6e-87	292.7
LXL04_025450	`PF00069.32`	Pkinase	1338	1598	4.9e-98	328.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O64477`	Arabidopsis thaliana	G-type lectin S-receptor-like serine/threonine-protein kinase At2g19130	53.836%	Swiss-Prot	weak database homology
`Q39203`	Arabidopsis thaliana	G-type lectin S-receptor-like serine/threonine-protein kinase SD2-2	42.175%	Swiss-Prot	weak database homology
`O81905`	Arabidopsis thaliana	Receptor-like serine/threonine-protein kinase SD1-8	37.703%	Swiss-Prot	weak database homology
`Q9T058`	Arabidopsis thaliana	G-type lectin S-receptor-like serine/threonine-protein kinase At4g11900	37.575%	Swiss-Prot	weak database homology
`Q39086`	Arabidopsis thaliana	Receptor-like serine/threonine-protein kinase SD1-7	35.616%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card