TkA06G051800 | RubberDandelionOmics

Gene overview

TkA06G051800

Reference: TK1151 Chr: Chr06 Coordinates: 14073682-14080671 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2116 bp · TkA06G051800|TK1151|cDNA

ATGCGGTGGAGTCGACAGGTTACGGGAGGAGTTGCTGCGTTTCAGATGGCTCAGCTACAGGATTTGTTGGCGACGGTGCAGGTGCGGGATTTACCTGATAAGTGGCGTTGGGAGTTAAACGGCTCCTTGGAGTTCTCGGTGGCTGTCGTTCGGGCTCACTTGGATGCGAGTACGCTCCCTACTGGTGCGAGTCCGACTAAATGGAATAGGTTCGTTCCCATAAAGATTAATGTTTTTGCTTGGCGGGTTGCTTCTAATCG...

CDS

Download CDS FASTA

918 bp · TkA06G051800|TK1151|CDS

ATGCGGTGGAGTCGACAGGTTACGGGAGGAGTTGCTGCGTTTCAGATGGCTCAGCTACAGGATTTGTTGGCGACGGTGCAGGTGCGGGATTTACCTGATAAGTGGCGTTGGGAGTTAAACGGCTCCTTGGAGTTCTCGGTGGCTGTCGTTCGGGCTCACTTGGATGCGAGTACGCTCCCTACTGGTGCGAGTCCGACTAAATGGAATAGGTTCGTTCCCATAAAGATTAATGTTTTTGCTTGGCGGGTTGCTTCTAATCG...

Protein

Download Protein FASTA

305 aa · TkA06G051800|TK1151|PROTEIN

MRWSRQVTGGVAAFQMAQLQDLLATVQVRDLPDKWRWELNGSLEFSVAVVRAHLDASTLPTGASPTKWNRFVPIKINVFAWRVASNRLPTRLNLEQKGIDVDTIMCPVCQREVESLAHILFKCEVAIAVWGRVANWCDAYMPVFDLYGEMTQWVDANTIDRRAKVDGVCCITMWVLWKFRNEVSVMQRPGLKVSPTSRARDEVVNPIDKGRAKGVRFPNRPIRLLQITEEFEEIPVQSRGFGILDDEAWAAGGNGILLKS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G051800`
TK1151 ID	TkA06G051800
OH-1004 ID	LXL04_004514
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	90.200
Protein coverage (%)	TK1151 59.344 / OH-1004 49.728 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G051800

Location Chr06:14073682-14080671 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g23120`	Essential for photosystem II (PSII) biogenesis.	The HCF136 protein is essential for assembly of the photosystem II reaction center in Arabidopsis thaliana.2002 · DOI: 10.1016/s0014-5793(02)03634-7 A nuclear-encoded protein of prokaryotic origin is essential for the stability of photosystem II in Arabidopsis thaliana.1998 · DOI: 10.1093/emboj/17.18.5286

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0729500`	Essential for photosystem II (PSII) biogenesis; required for assembly of an early intermediate in PSII assembly that includes D2 (psbD) and cytochrome b559.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_004514 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0003676 nucleic acid binding Molecular Function

GO:0004523 RNA-DNA hybrid ribonuclease activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.424

Rank 1 · TkA06G051800 · TK1151

Nucleus0.277

Rank 2 · TkA06G051800 · TK1151

Cell membrane0.198

Rank 3 · TkA06G051800 · TK1151

Golgi apparatus0.090

Rank 4 · TkA06G051800 · TK1151

Endoplasmic reticulum0.089

Rank 5 · TkA06G051800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13966zf-RVT66-130 aa

PF13966zf-RVT169-183 aa

PF14870PSII_BNR229-303 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G051800	`PF13966`	zf-RVT	66	130	7.2e-17	62.5
TkA06G051800	`PF13966`	zf-RVT	169	183	7.2e-17	62.5
TkA06G051800	`PF14870`	PSII_BNR	229	303	6.1e-20	72.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O82660`	Arabidopsis thaliana	sp\|O82660\|P2SAF_ARATH Photosystem II stability/assembly factor HCF136, chloroplastic	75.300%	Swiss-Prot	Low
`Q5Z5A8`	Oryza sativa subsp. japonica	sp\|Q5Z5A8\|P2SAF_ORYSJ Photosystem II stability/assembly factor HCF136, chloroplastic	74.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card