TkA06G049660 | RubberDandelionOmics

Gene overview

TkA06G049660

Reference: TK1151 Chr: Chr06 Coordinates: 13514358-13516654 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1798 bp · TkA06G049660|TK1151|cDNA

GGAAAAAAGAGGGAAAAAAAAGAAAAAACGATTAAAATATCTCTAACTCCCTCACGGCTCAACTACAAAATATCTTTACCCCCAGCGTCTCCTCTGCCCCCACCTCCACTCCCATCTGATCGGAGCTCAGCAGCTCACCATGCATTCCATGATCGTTTCACCATCCACCTTAACGCCATCAAGTTCATCGATCATACCACTAACACCTCTCAAATCAAAAGCATTCATCACCGCATCTCCAAATTTTTGGAGAAAGTCTC...

CDS

Download CDS FASTA

1452 bp · TkA06G049660|TK1151|CDS

ATGCATTCCATGATCGTTTCACCATCCACCTTAACGCCATCAAGTTCATCGATCATACCACTAACACCTCTCAAATCAAAAGCATTCATCACCGCATCTCCAAATTTTTGGAGAAAGTCTCGTTCTGATTCTGCCTCGCTGCAATGTAAAGCTTCAGCATCTTCATCTTCTTCTATCACTGATTTCGATCTGTATGATCTGCTCGGTGTCGATAGTTCCTCCGACCAGTCTGCCATCAAACAGGCGTACAGGTCACTTCA...

Protein

Download Protein FASTA

483 aa · TkA06G049660|TK1151|PROTEIN

MHSMIVSPSTLTPSSSSIIPLTPLKSKAFITASPNFWRKSRSDSASLQCKASASSSSSITDFDLYDLLGVDSSSDQSAIKQAYRSLQKKCHPDIAGLAGHDMAIILNEAYAVLSDPLSRFSYDKEQAKVADFKGYTGKPIYSVWYGSESEQRAIFVDEVKCIGCLKCALLAEKTFAVESVYGRARVIAQWADSENKIQEAIEACPVDCISMVERSKLAALEFLMSKQPRGSVRIGAGNTAGTRVSNIFVDVDKFQDQYLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G049660`
TK1151 ID	TkA06G049660
OH-1004 ID	LXL04_025600
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 90.683 / OH-1004 98.206 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G049660

Location Chr06:13514358-13516654 (-)

Description Similar to DJC76: Chaperone protein dnaJ C76, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g23240`	May function together with HSC70 chaperone to assist protein folding and prevent protein aggregation during salt stress in the chloroplast (Probable).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025600 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006260 DNA replication Biological Process

GO:0009408 response to heat Biological Process

GO:0042026 protein refolding Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009295 nucleoid Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003681 bent DNA binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0031072 heat shock protein binding Molecular Function

GO:0051082 unfolded protein binding Molecular Function

KEGG gene cross-reference

ath:AT5G23240

cyn:Cyan7425_4692

dth:DICTH_1724

pen:PSEEN4896

tte:TTE0956

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.973

Rank 1 · TkA06G049660 · TK1151

Nucleus0.034

Rank 2 · TkA06G049660 · TK1151

Mitochondrion0.025

Rank 3 · TkA06G049660 · TK1151

Cytoplasm0.020

Rank 4 · TkA06G049660 · TK1151

Peroxisome0.014

Rank 5 · TkA06G049660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00226DnaJ63-123 aa

PF30912TIM141_C67-114 aa

PF12838Fer4_7147-168 aa

PF13459Fer4_15154-211 aa

PF14697Fer4_21155-211 aa

PF00037Fer4155-168 aa

PF12837Fer4_6155-168 aa

PF13370Fer4_13156-210 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G049660	`PF00226`	DnaJ	63	123	8.6e-14	52.1
TkA06G049660	`PF30912`	TIM141_C	67	114	0.0077	16.9
TkA06G049660	`PF12838`	Fer4_7	147	168	0.06	14.5
TkA06G049660	`PF13459`	Fer4_15	154	211	4.1e-07	31.3
TkA06G049660	`PF14697`	Fer4_21	155	211	0.00055	20.7
TkA06G049660	`PF00037`	Fer4	155	168	0.12	12.9
TkA06G049660	`PF12837`	Fer4_6	155	168	3.3	8.5
TkA06G049660	`PF13370`	Fer4_13	156	210	3.4e-14	54.0
TkA06G049660	`PF00037`	Fer4	201	210	0.12	12.9
TkA06G049660	`PF12838`	Fer4_7	202	216	0.06	14.5
TkA06G049660	`PF12837`	Fer4_6	202	209	3.3	8.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FMX6`	Arabidopsis thaliana	sp\|Q9FMX6\|DJC76_ARATH Chaperone protein dnaJ C76, chloroplastic	55.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card