TkA06G047590 | RubberDandelionOmics

Gene overview

TkA06G047590

Reference: TK1151 Chr: Chr06 Coordinates: 12882058-12895713 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2551 bp · TkA06G047590|TK1151|cDNA

TTTTGAGTTCACTTCACAACATTTTAATTGTTTAGGTGTAAAAGCACTCTATCCACTCACAATTGCTCCCGCGAAAGTAGTTTCCAGATTTTGGATAAGAGGCAAGGGGAGCGAGAGAGGAAGAGAGAAGGAGTTAGAATTTTGAGCACAATGACAATGGTGGCTGCGAAGCTGGTAACTGATTGTTCAAACGCAATCACAGCGATAAAGCCTCGTCTCTTCTCAATTCTTTGTTCAATCATCGCCATCCTATTCTATTC...

CDS

Download CDS FASTA

621 bp · TkA06G047590|TK1151|CDS

ATGATTGACACTCCAACAGTCCAACGCTTCCAACTTCGACTATATCGCCATCGTCGGAGCTTCCAAGACAAAAAACCTTCCATCACCAATATCTATAAACCGAGGCCTTATTTCTCCTTCAAATTCATTTGTGGCGACCCCTACAATAGCTTCGCTTCGCTTCTCTTTCTCTTCACGTACCGTATTCCCATCACTCATGGCTGCGTCTGCTTCTTTCGCCGGATCGGCTGTCGCCGCTTTCAAATCCACTGGAATCTCAG...

Protein

Download Protein FASTA

206 aa · TkA06G047590|TK1151|PROTEIN

MIDTPTVQRFQLRLYRHRRSFQDKKPSITNIYKPRPYFSFKFICGDPYNSFASLLFLFTYRIPITHGCVCFFRRIGCRRFQIHWNLREVCPRESLLFPQNASSLQLQRSFNYSQCRSKMSFASSGVKAQVATIAQASVEATAPVVIVTGASRGIGKAVALALGKAGCKVLVNYARSSKEAEEVCKEIESVGVKHLHLGEMFQKKKM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G047590`
TK1151 ID	TkA06G047590
OH-1004 ID	LXL04_025644
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	91.200
Protein coverage (%)	TK1151 49.515 / OH-1004 6.934 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G047590

Location Chr06:12882058-12895713 (-)

Description Similar to CLKR27: 3-oxoacyl-[acyl-carrier-protein] reductase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g24360`	3-oxoacyl-[acyl-carrier-protein] reductase, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025644 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0009507 chloroplast Cellular Component

GO:0004316 3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity Molecular Function

GO:0051287 NAD binding Molecular Function

KEGG gene cross-reference

bna:106367337

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.645

Rank 1 · TkA06G047590 · TK1151

Mitochondrion0.271

Rank 2 · TkA06G047590 · TK1151

Cytoplasm0.102

Rank 3 · TkA06G047590 · TK1151

Nucleus0.091

Rank 4 · TkA06G047590 · TK1151

Peroxisome0.019

Rank 5 · TkA06G047590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08659KR84-103 aa

PF12242Eno-Rase_NADH_b126-163 aa

PF02882THF_DHG_CYH_C131-201 aa

PF00106adh_short144-193 aa

PF01488Shikimate_DH144-200 aa

PF08659KR145-193 aa

PF01370Epimerase145-194 aa

PF13561adh_short_C2149-192 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G047590	`PF08659`	KR	84	103	0.003	18.2
TkA06G047590	`PF12242`	Eno-Rase_NADH_b	126	163	0.21	12.1
TkA06G047590	`PF02882`	THF_DHG_CYH_C	131	201	0.019	15.2
TkA06G047590	`PF00106`	adh_short	144	193	4.9e-11	43.2
TkA06G047590	`PF01488`	Shikimate_DH	144	200	0.33	11.8
TkA06G047590	`PF08659`	KR	145	193	0.003	18.2
TkA06G047590	`PF01370`	Epimerase	145	194	0.21	11.7
TkA06G047590	`PF13561`	adh_short_C2	149	192	0.00078	19.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P33207`	Arabidopsis thaliana	sp\|P33207\|FABG_ARATH 3-oxoacyl-[acyl-carrier-protein] reductase, chloroplastic	58.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card