TkA06G046350 | RubberDandelionOmics

Gene overview

TkA06G046350

Reference: TK1151 Chr: Chr06 Coordinates: 12559718-12562003 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1266 bp · TkA06G046350|TK1151|cDNA

ATGGGCTCATATGATAATTCGTCTTCGCCTTGTTATGAGATTGTATTACCAATTTATAAAGGAAATCGATCCTCTTGGGGACAACTTGTAAACCTCACCAATGAAAAGATCGACTCTTTGATGTATTTCTGTGATGAGATATATGTTTCAGAAGTTGAAGACAAGTACAGCGAGCCTCTGCCATGGATTGGGATCTACATCTCAATGGCATCATTATTTTGCATTCTCGCTATGGTAGCTGATCTGGTCAATGGAATTCA...

CDS

Download CDS FASTA

1266 bp · TkA06G046350|TK1151|CDS

ATGGGCTCATATGATAATTCGTCTTCGCCTTGTTATGAGATTGTATTACCAATTTATAAAGGAAATCGATCCTCTTGGGGACAACTTGTAAACCTCACCAATGAAAAGATCGACTCTTTGATGTATTTCTGTGATGAGATATATGTTTCAGAAGTTGAAGACAAGTACAGCGAGCCTCTGCCATGGATTGGGATCTACATCTCAATGGCATCATTATTTTGCATTCTCGCTATGGTAGCTGATCTGGTCAATGGAATTCA...

Protein

Download Protein FASTA

421 aa · TkA06G046350|TK1151|PROTEIN

MGSYDNSSSPCYEIVLPIYKGNRSSWGQLVNLTNEKIDSLMYFCDEIYVSEVEDKYSEPLPWIGIYISMASLFCILAMVADLVNGIHKRKFWFPCKVFSLNAVSITMMAVAMKLPVDLNSPMPGWVDQAAKRVSLVFMCMMMANVMPSLASMDNKSLCANVIGLAILIITIIVNIFFEINTGVMGSYYLNSLKGMMLSPPSNHGDTYEDLGTYVLLLEDNTELPERTLKRILNYVNRLIQKAEKEQDNNLVQFLEKSTGF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G046350`
TK1151 ID	TkA06G046350
OH-1004 ID	LXL04_025669
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	54.900
Protein coverage (%)	TK1151 100.000 / OH-1004 42.705 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G046350`
Location	Chr06:12559718-12562003 (+)
Description	Similar to RPS3A: 40S ribosomal protein S3-1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025669` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006412 translation Biological Process GO:0000325 plant-type vacuole Cellular Component GO:0005634 nucleus Cellular Component GO:0005730 nucleolus Cellular Component GO:0005777 peroxisome Cellular Component GO:0005829 cytosol Cellular Component GO:0009506 plasmodesma Cellular Component GO:0009507 chloroplast Cellular Component GO:0009536 plastid Cellular Component GO:0022626 cytosolic ribosome Cellular Component GO:0022627 cytosolic small ribosomal subunit Cellular Component GO:0003729 mRNA binding Molecular Function
KEGG gene cross-reference	ath:AT2G31610 ath:AT3G53870 ath:AT5G35530 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.318

Rank 1 · TkA06G046350 · TK1151

Endoplasmic reticulum0.268

Rank 2 · TkA06G046350 · TK1151

Cytoplasm0.213

Rank 3 · TkA06G046350 · TK1151

Golgi apparatus0.181

Rank 4 · TkA06G046350 · TK1151

Nucleus0.171

Rank 5 · TkA06G046350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20310HTH_Tnp_2177-247 aa

PF23135TRI4_N207-256 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G046350	`PF20310`	HTH_Tnp_2	177	247	0.046	14.3
TkA06G046350	`PF23135`	TRI4_N	207	256	0.36	11.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card