LXL04_025669 | RubberDandelionOmics

Gene overview

LXL04_025669

Reference: OH-1004 Chr: Chr05 Coordinates: 115007977-115019271 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5349 bp · LXL04_025669|LXL04_025669|OH1004|cDNA

ATGGGCTCATATGATAATTCGTCTTCGCCTTGTTATGAGATTGTATTACCAATTTATAAAGGAAATCGATCCTCTTGGGGACAACTTGTAAACCTCACCAATGAAAAGATCGACTCTTTGATGTATTTCTGTGATGAGATATATGTTTCAGAAGTTGAAGACAAGTACAGCGAGCCTCTGCCATGGATTGGGATCTACATCTCAATGGCATCATTATTTTGCATTCTCGCTATGGTAGCTGATCTGGTCAATGGAATTCA...

CDS

Download CDS FASTA

5349 bp · LXL04_025669|LXL04_025669|OH1004|CDS

ATGGGCTCATATGATAATTCGTCTTCGCCTTGTTATGAGATTGTATTACCAATTTATAAAGGAAATCGATCCTCTTGGGGACAACTTGTAAACCTCACCAATGAAAAGATCGACTCTTTGATGTATTTCTGTGATGAGATATATGTTTCAGAAGTTGAAGACAAGTACAGCGAGCCTCTGCCATGGATTGGGATCTACATCTCAATGGCATCATTATTTTGCATTCTCGCTATGGTAGCTGATCTGGTCAATGGAATTCA...

Protein

Download Protein FASTA

1782 aa · LXL04_025669|LXL04_025669|OH1004|PROTEIN

MGSYDNSSSPCYEIVLPIYKGNRSSWGQLVNLTNEKIDSLMYFCDEIYVSEVEDKYSEPLPWIGIYISMASLFCILAMVADLVNGIHKRKFWFPCKVFSLNAVSITMMAVAMKLPVDLNSPMPGWVDQAAKRVSLVFMCMMMANVMPSLASMDNKSLCANVIGLAILIITIIVNIFFEINTGVMGREGSIPAINEHTFMDDGYMYVALLLFILILLISSAITVPISKQILELKYQSISKKTLYYHCPHDTFAIEKLRQHV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025669`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025669

Location Chr05:115007977-115019271 (-)

Description Similar to RPS3A: 40S ribosomal protein S3-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g31610`	Small ribosomal subunit protein uS3z.	No verified direct reference in this release
`At5g35530`	Small ribosomal subunit protein uS3x.	No verified direct reference in this release
`At3g53870`	Small ribosomal subunit protein uS3y.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025669 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006412 translation Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0022626 cytosolic ribosome Cellular Component

GO:0022627 cytosolic small ribosomal subunit Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT2G31610

ath:AT3G53870

ath:AT5G35530

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.313

Rank 1 · LXL04_025669 · OH-1004

Mitochondrion0.282

Rank 2 · LXL04_025669 · OH-1004

Endoplasmic reticulum0.117

Rank 3 · LXL04_025669 · OH-1004

Nucleus0.094

Rank 4 · LXL04_025669 · OH-1004

Cell membrane0.086

Rank 5 · LXL04_025669 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07650.24KH_2849-923 aa

PF00189.26Ribosomal_S3_C935-1017 aa

PF13041.13PPR_21122-1151 aa

PF23276.3TPR_241122-1231 aa

PF13812.13PPR_31126-1181 aa

PF12854.14PPR_11133-1166 aa

PF01535.27PPR1140-1170 aa

PF13041.13PPR_21146-1185 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025669	`PF07650.24`	KH_2	849	923	2.2e-17	63.4
LXL04_025669	`PF00189.26`	Ribosomal_S3_C	935	1017	9e-32	110.2
LXL04_025669	`PF13041.13`	PPR_2	1122	1151	1.2e-112	368.6
LXL04_025669	`PF23276.3`	TPR_24	1122	1231	4.9e-33	114.6
LXL04_025669	`PF13812.13`	PPR_3	1126	1181	6.5e-50	167.8
LXL04_025669	`PF12854.14`	PPR_1	1133	1166	1.9e-84	277.7
LXL04_025669	`PF01535.27`	PPR	1140	1170	3.4e-78	253.3
LXL04_025669	`PF13041.13`	PPR_2	1146	1185	1.2e-112	368.6
LXL04_025669	`PF17177.11`	PPR_long	1158	1305	3e-32	112.5
LXL04_025669	`PF12854.14`	PPR_1	1169	1198	1.9e-84	277.7
LXL04_025669	`PF12854.14`	PPR_1	1202	1233	1.9e-84	277.7
LXL04_025669	`PF13812.13`	PPR_3	1204	1250	6.5e-50	167.8
LXL04_025669	`PF13041.13`	PPR_2	1205	1252	1.2e-112	368.6
LXL04_025669	`PF01535.27`	PPR	1207	1237	3.4e-78	253.3
LXL04_025669	`PF23276.3`	TPR_24	1226	1337	4.9e-33	114.6
LXL04_025669	`PF13041.13`	PPR_2	1239	1288	1.2e-112	368.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SIP7`	Arabidopsis thaliana	Small ribosomal subunit protein uS3z	88.703%	Swiss-Prot	weak database homology
`Q9FJA6`	Arabidopsis thaliana	Small ribosomal subunit protein uS3x	85.020%	Swiss-Prot	weak database homology
`Q9M339`	Arabidopsis thaliana	Small ribosomal subunit protein uS3y	92.593%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card