TkA06G041430 | RubberDandelionOmics

Gene overview

TkA06G041430

Reference: TK1151 Chr: Chr06 Coordinates: 11208599-11213352 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3522 bp · TkA06G041430|TK1151|cDNA

CTGCATGAGCTGGTATCACACCCTCCTTATATTCTTCTCCAAAGCAAGAAGAAAAAGGCGAACCTGAGATTCTGTTCATAAAGAAAAGCAAGATTTGAAAAATCAGGAAAAACAGACAGAATGTGAATCAACGCTGCACACAAACTCATCAATCAATCAAAAAAAGCTGAGTTCAAGTGGAGTCCAGACTCCGAGAGATGTCGATCCAAGAACTAATTCACTGAAATGCAGCCATTTCCTCACAATCTTCAACCCTTTTC...

CDS

Download CDS FASTA

2805 bp · TkA06G041430|TK1151|CDS

ATGGGTTTAGTTCTTCAATTTGTCTTACTCTTCCTCACCTGCTTAATCCCTTCCCTTCTCTGTCAAGTTACAGAATTTGTGAGTATCGATTGTGGAGGAACAAGTAATCACACCGACGTTGATACTGGTCTAGTATGGGTTTCGGATTCTGGAATCGTTCACCATGGAACATCAATTGAGCTCGAAAACCCCAACGGGAACTCAGTTCAGTATCAAAGGCGCAGAGATTTCCCCATAGACAACAAAAAGTATTGTTATAC...

Protein

Download Protein FASTA

934 aa · TkA06G041430|TK1151|PROTEIN

MGLVLQFVLLFLTCLIPSLLCQVTEFVSIDCGGTSNHTDVDTGLVWVSDSGIVHHGTSIELENPNGNSVQYQRRRDFPIDNKKYCYTLNTTERRRYIVRTTFLYGSSENENTYPKFQLYLDATRWATVSVLDASTVYIKEMIIRAPSSSIDVCVCCATTGSPFLSTLELRPLNLSMYATDFEDNFFLKVAARVNFGASSTDAVRFPDDPYDRIWDSDLAKRQNFLVGVAPGTVRINTTKEINTNTREYPPVKVMQTAVVG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G041430`
TK1151 ID	TkA06G041430
OH-1004 ID	LXL04_025785
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G041430

Location Chr06:11208599-11213352 (-)

Description Similar to At1g67720: Probable LRR receptor-like serine/threonine-protein kinase At1g67720

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g67720`	Probable LRR receptor-like serine/threonine-protein kinase At1g67720.	No verified direct reference in this release
`At3g21340`	Probable receptor with a dual specificity kinase activity acting on both serine/threonine- and tyrosine-containing substrates.	No verified direct reference in this release
`At1g51860`	Probable LRR receptor-like serine/threonine-protein kinase At1g51860.	No verified direct reference in this release
`At1g51880`	Probable LRR receptor-like serine/threonine-protein kinase At1g51880.	No verified direct reference in this release
`At5g48740`	Probable LRR receptor-like serine/threonine-protein kinase At5g48740.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025785 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004714 transmembrane receptor protein tyrosine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G67720

ath:AT2G14510

ath:AT2G19230

ath:AT3G21340

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.863

Rank 1 · TkA06G041430 · TK1151

Endoplasmic reticulum0.079

Rank 2 · TkA06G041430 · TK1151

Cytoplasm0.077

Rank 3 · TkA06G041430 · TK1151

Nucleus0.045

Rank 4 · TkA06G041430 · TK1151

Lysosome / Vacuole0.031

Rank 5 · TkA06G041430 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12819Malectin_like29-362 aa

PF24141LRR_ComC255-311 aa

PF13855LRR_8414-451 aa

PF12799LRR_4415-451 aa

PF00560LRR_1416-436 aa

PF24141LRR_ComC424-502 aa

PF23598LRR_14428-491 aa

PF25019LRR_R13L1-DRL21435-493 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G041430	`PF12819`	Malectin_like	29	362	3.2e-83	280.5
TkA06G041430	`PF24141`	LRR_ComC	255	311	0.001	19.6
TkA06G041430	`PF13855`	LRR_8	414	451	7.8e-07	29.5
TkA06G041430	`PF12799`	LRR_4	415	451	1.8e-09	38.2
TkA06G041430	`PF00560`	LRR_1	416	436	3.7e-09	35.6
TkA06G041430	`PF24141`	LRR_ComC	424	502	0.001	19.6
TkA06G041430	`PF23598`	LRR_14	428	491	0.0016	18.0
TkA06G041430	`PF25019`	LRR_R13L1-DRL21	435	493	0.031	14.9
TkA06G041430	`PF13855`	LRR_8	438	496	7.8e-07	29.5
TkA06G041430	`PF00560`	LRR_1	439	455	3.7e-09	35.6
TkA06G041430	`PF12799`	LRR_4	461	500	1.8e-09	38.2
TkA06G041430	`PF00560`	LRR_1	461	483	3.7e-09	35.6
TkA06G041430	`PF00560`	LRR_1	485	504	3.7e-09	35.6
TkA06G041430	`PF16492`	Cadherin_C_2	531	569	0.28	12.6
TkA06G041430	`PF07714`	PK_Tyr_Ser-Thr	616	882	1.8e-52	178.9
TkA06G041430	`PF00069`	Pkinase	617	825	1.7e-46	159.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`C0LGI2`	Arabidopsis thaliana	sp\|C0LGI2\|Y1677_ARATH Probable LRR receptor-like serine/threonine-protein kinase At1g67720	68.400%	Swiss-Prot	High
`Q9LIG2`	Arabidopsis thaliana	sp\|Q9LIG2\|RLK6_ARATH Receptor-like protein kinase At3g21340	32.600%	Swiss-Prot	Medium
`C0LGG4`	Arabidopsis thaliana	sp\|C0LGG4\|Y1518_ARATH Probable LRR receptor-like serine/threonine-protein kinase At1g51860	32.800%	Swiss-Prot	Medium
`Q9FZB1`	Arabidopsis thaliana	sp\|Q9FZB1\|Y5188_ARATH Probable LRR receptor-like serine/threonine-protein kinase At1g51880	31.000%	Swiss-Prot	Medium
`C0LGV0`	Arabidopsis thaliana	sp\|C0LGV0\|Y5487_ARATH Probable LRR receptor-like serine/threonine-protein kinase At5g48740	42.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card