TkA06G036990 | RubberDandelionOmics

Gene overview

TkA06G036990

Reference: TK1151 Chr: Chr06 Coordinates: 9913673-9920743 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1867 bp · TkA06G036990|TK1151|cDNA

AATACTTGGCTAAAAGTCCCAAAACAGCGCCACGTGTTTTGCTACAGGCGACGAGGACCACGATTTCGAACATTGAGACACAGACTTTTAGATTCACTCAACGCCTTCCTTTCAAGTCTCAACTACTCCCTCTTTGCTCCCCTAAAATTTCCAACTATTCTCACCCCAAAAGTCAAATCAGCTGAAGAACTCCACTCAATTTACACGGCTCTGGTCTCGGTGGCTAGCTTTACATCTATGGCGGCCTCGAAATTCCATAT...

CDS

Download CDS FASTA

1587 bp · TkA06G036990|TK1151|CDS

AATACTTGGCTAAAAGTCCCAAAACAGCGCCACGTGTTTTGCTACAGGCGACGAGGACCACGATTTCGAACATTGAGACACAGACTTTTAGATTCACTCAACGCCTTCCTTTCAAGTCTCAACTACTCCCTCTTTGCTCCCCTAAAATTTCCAACTATTCTCACCCCAAAAGTCAAATCAGCTGAAGAACTCCACTCAATTTACACGGCTCTGGTCTCGGTGGCTAGCTTTACATCTATGGCGGCCTCGAAATTCCATAT...

Protein

Download Protein FASTA

528 aa · TkA06G036990|TK1151|PROTEIN

NTWLKVPKQRHVFCYRRRGPRFRTLRHRLLDSLNAFLSSLNYSLFAPLKFPTILTPKVKSAEELHSIYTALVSVASFTSMAASKFHIFLVVSLFFALIFTLSEADSGVEEVVVESDNSEAFRIEVDKLTSKIQSLESSIEKRNQELKSKDDTIAEKEKAITEIEKTIKEKSDSITSLKNEVAKLEVKVSLDSNEKVKKAHTKAHELEKQVEKLQMEIEYKNNLREAMEARTKELEKKVHDLNPKLQDLQHIVDEQNTQLQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G036990`
TK1151 ID	TkA06G036990
OH-1004 ID	LXL04_023420
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	85.300
Protein coverage (%)	TK1151 28.409 / OH-1004 57.471 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G036990`
Location	Chr06:9913673-9920743 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_023420` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.563

Rank 1 · TkA06G036990 · TK1151

Cytoplasm0.162

Rank 2 · TkA06G036990 · TK1151

Nucleus0.158

Rank 3 · TkA06G036990 · TK1151

Golgi apparatus0.118

Rank 4 · TkA06G036990 · TK1151

Cell membrane0.081

Rank 5 · TkA06G036990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06785UPF024270-248 aa

PF28006HpsJ87-210 aa

PF07009NusG_II88-177 aa

PF09969DUF220398-184 aa

PF04513Baculo_PEP_C100-192 aa

PF25762HAUS1105-217 aa

PF30378CEP135_TSGA10_CC108-274 aa

PF30964At4g38062_N109-205 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G036990	`PF06785`	UPF0242	70	248	0.0046	17.8
TkA06G036990	`PF28006`	HpsJ	87	210	3.9	7.8
TkA06G036990	`PF07009`	NusG_II	88	177	0.1	13.5
TkA06G036990	`PF09969`	DUF2203	98	184	9.3	7.7
TkA06G036990	`PF04513`	Baculo_PEP_C	100	192	0.87	10.4
TkA06G036990	`PF25762`	HAUS1	105	217	4.8	7.6
TkA06G036990	`PF30378`	CEP135_TSGA10_CC	108	274	0.0091	15.1
TkA06G036990	`PF30964`	At4g38062_N	109	205	0.00024	20.7
TkA06G036990	`PF00038`	Filament	110	183	0.0072	16.7
TkA06G036990	`PF06818`	Fez1	111	229	0.11	13.6
TkA06G036990	`PF05531`	NPV_P10	111	141	0.37	12.0
TkA06G036990	`PF08702`	Fib_alpha	113	172	0.03	15.2
TkA06G036990	`PF27720`	SSNA1	113	163	3.9	8.4
TkA06G036990	`PF19220`	Rod_CreS	114	282	0.00032	20.7
TkA06G036990	`PF11932`	DUF3450	114	179	5.9	6.8
TkA06G036990	`PF00261`	Tropomyosin	115	168	7.1e-06	26.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card