Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2000 bp · TkA06G027970|TK1151|cDNA
CTAGCCCTCCCACTTGTTTGTTCGATTCACAAACGTCAGAATACAGGCTTCTACCCTCTTCTCTTCCTCTTTCGGGAATCTCTTCTTTCGTTTCACTTCATCTGTCTATATATTTATCCATCTTTGTTCGTGATTTCGAAATTTTCTTTGCACAATGGGTTACGAGAACGATCCCTATCGTGATGAAGATGGCGAGCCGTTGATGGATTACGACGACGGATTTCAATCCGATCACGGTGATGATAACAACAATCAACCTC...
1581 bp · TkA06G027970|TK1151|CDS
ATGGGTTACGAGAACGATCCCTATCGTGATGAAGATGGCGAGCCGTTGATGGATTACGACGACGGATTTCAATCCGATCACGGTGATGATAACAACAATCAACCTCAAAATCAACACCTTCTTGATGACAATCTCGATGACGAATTGGAAGATAATGATTGGCAGAGTAATAGGCAGGAACGGTCTCCGACGCCGGTATTCAACGAATCCGATTCGAAGTCGAAGCCTCGAAAAAGGTTAATCAAGAAGAGCACGGCAGA...
Protein
Download Protein FASTA526 aa · TkA06G027970|TK1151|PROTEIN
MGYENDPYRDEDGEPLMDYDDGFQSDHGDDNNNQPQNQHLLDDNLDDELEDNDWQSNRQERSPTPVFNESDSKSKPRKRLIKKSTAEETLPDFAIDDDVEDEMATFVRDDSDSGGGKRKKFSSGGGSSSKKREKKSSASKFSDRGGRSSDKGGSKFKSNSKRGGRSGGDDAEVKEMWDTIAGGDSEDDKDGPRMLDDDNFIDDTGVDPADRYASDHGGYSPSRAPQAEEGEEDDEIKDMFKMGKKKKKSEKSAAEIALLV...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA06G027970 |
|---|---|
| TK1151 ID | TkA06G027970 |
| OH-1004 ID | LXL04_026091 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA06G027970 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr06:7560902-7563979 (+) | |||||||||
| Description | Similar to IWS1: Protein IWS1 homolog 1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006338 chromatin remodeling Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006397 mRNA processing Biological Process GO:0008380 RNA splicing Biological Process GO:0009742 brassinosteroid mediated signaling pathway Biological Process GO:0010467 gene expression Biological Process GO:0010793 regulation of mRNA export from nucleus Biological Process GO:0016973 poly(A)+ mRNA export from nucleus Biological Process GO:0023052 signaling Biological Process GO:0032784 regulation of DNA-templated transcription elongation Biological Process GO:0050684 regulation of mRNA processing Biological Process GO:0140673 transcription elongation-coupled chromatin remodeling Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G32130 hsa:55677 mmu:73473 rno:291705 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF08711Med26285-298 aaPF08711Med26354-394 aaPF18845baeRF_family3471-515 aaPF08711Med26477-488 aaPF08711Med26497-515 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA06G027970 | PF08711 | Med26 | 285 | 298 | 1.1e-12 | 48.2 |
| TkA06G027970 | PF08711 | Med26 | 354 | 394 | 1.1e-12 | 48.2 |
| TkA06G027970 | PF18845 | baeRF_family3 | 471 | 515 | 0.11 | 13.5 |
| TkA06G027970 | PF08711 | Med26 | 477 | 488 | 1.1e-12 | 48.2 |
| TkA06G027970 | PF08711 | Med26 | 497 | 515 | 1.1e-12 | 48.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.