TkA06G000850 | RubberDandelionOmics

Gene overview

TkA06G000850

Reference: TK1151 Chr: Chr06 Coordinates: 170565-173082 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1608 bp · TkA06G000850|TK1151|cDNA

GAGGTGATTGATGAGGAAGTAGTTGAGGCACGAGTTCCTTTTGTTGCGCGAACCCAGCAGTGTTTTGCTGTGAAGGCCGGGATAGATGGACTTCTGGATATTGCACGCAGATCCTTCTGTGACACCAGCCAAGCCATACACAACCTCGCAAATAAGTATCGTGAAGATTATAAGCTTCCGAATTTGAAAATCCCGTTTAACAATAGGCATGGGTTTTACTTGAATATTCCTGTCAAGGACATACAGGGAAAGCTTCCCAG...

CDS

Download CDS FASTA

1365 bp · TkA06G000850|TK1151|CDS

GAGGTGATTGATGAGGAAGTAGTTGAGGCACGAGTTCCTTTTGTTGCGCGAACCCAGCAGTGTTTTGCTGTGAAGGCCGGGATAGATGGACTTCTGGATATTGCACGCAGATCCTTCTGTGACACCAGCCAAGCCATACACAACCTCGCAAATAAGTATCGTGAAGATTATAAGCTTCCGAATTTGAAAATCCCGTTTAACAATAGGCATGGGTTTTACTTGAATATTCCTGTCAAGGACATACAGGGAAAGCTTCCCAG...

Protein

Download Protein FASTA

454 aa · TkA06G000850|TK1151|PROTEIN

EVIDEEVVEARVPFVARTQQCFAVKAGIDGLLDIARRSFCDTSQAIHNLANKYREDYKLPNLKIPFNNRHGFYLNIPVKDIQGKLPSNFIQVMKHGNSIHCSTLDLASLNARNKSAAEECYLRTEACLEGLMDGIREDVSVLTLLAEILCLLDMIVNSFAHMISTKPVDRYTRPHFTENGPLAIDAGRHPILECVHNDFVPNNIFLSEASNMVVVMGPNMSGKSTYLEQICLIVILAQIGCYIPARFATLRVVDRIFTRM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G000850`
TK1151 ID	TkA06G000850
OH-1004 ID	LXL04_026608
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	94.600
Protein coverage (%)	TK1151 100.000 / OH-1004 58.824 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G000850

Location Chr06:170565-173082 (+)

Description Similar to MSH4: DNA mismatch repair protein MSH4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g17380`	Involved in meiotic recombination in association with MSH5.	The Arabidopsis MutS homolog AtMSH4 functions at an early step in recombination: evidence for two classes of recombination in Arabidopsis.2004 · DOI: 10.1101/gad.317504 Zip4/Spo22 is required for class I CO formation but not for synapsis completion in Arabidopsis thaliana.2007 · DOI: 10.1371/journal.pgen.0030083 Replication protein A (AtRPA1a) is required for class I crossover formation but is dispensable for meiotic DNA break repair.2009 · DOI: 10.1038/emboj.2008.295

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026608 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006298 mismatch repair Biological Process

GO:0007129 homologous chromosome pairing at meiosis Biological Process

GO:0007131 reciprocal meiotic recombination Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0007292 female gamete generation Biological Process

GO:0010777 meiotic mismatch repair involved in reciprocal meiotic recombination Biological Process

GO:0045143 homologous chromosome segregation Biological Process

GO:0051321 meiotic cell cycle Biological Process

GO:0000228 nuclear chromosome Cellular Component

GO:0000793 condensed chromosome Cellular Component

GO:0000794 condensed nuclear chromosome Cellular Component

GO:0000795 synaptonemal complex Cellular Component

KEGG gene cross-reference

ath:AT4G17380

cya:CYA_2035

hsa:4438

mmu:55993

sce:YFL003C

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.541

Rank 1 · TkA06G000850 · TK1151

Nucleus0.498

Rank 2 · TkA06G000850 · TK1151

Mitochondrion0.073

Rank 3 · TkA06G000850 · TK1151

Cell membrane0.042

Rank 4 · TkA06G000850 · TK1151

Lysosome / Vacuole0.023

Rank 5 · TkA06G000850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05190MutS_IV27-118 aa

PF27394Aq_aa27190-237 aa

PF13514AAA_27206-230 aa

PF13476AAA_23210-233 aa

PF13173AAA_14211-299 aa

PF00910RNA_helicase213-326 aa

PF00488MutS_V214-399 aa

PF15148Apolipo_F218-267 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G000850	`PF05190`	MutS_IV	27	118	1.2e-14	55.1
TkA06G000850	`PF27394`	Aq_aa27	190	237	0.084	13.4
TkA06G000850	`PF13514`	AAA_27	206	230	0.16	12.3
TkA06G000850	`PF13476`	AAA_23	210	233	0.16	13.3
TkA06G000850	`PF13173`	AAA_14	211	299	0.18	12.5
TkA06G000850	`PF00910`	RNA_helicase	213	326	0.051	14.8
TkA06G000850	`PF00488`	MutS_V	214	399	3.7e-67	226.7
TkA06G000850	`PF15148`	Apolipo_F	218	267	0.032	14.5
TkA06G000850	`PF15148`	Apolipo_F	314	338	0.032	14.5
TkA06G000850	`PF13476`	AAA_23	397	435	0.16	13.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JP48`	Arabidopsis thaliana	sp\|F4JP48\|MSH4_ARATH DNA mismatch repair protein MSH4	75.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card