LXL04_026608 | RubberDandelionOmics

Gene overview

LXL04_026608

Reference: OH-1004 Chr: Chr05 Coordinates: 129447158-129451904 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2451 bp · LXL04_026608|LXL04_026608|OH1004|cDNA

ATGGAAGACGACACGGGAGAGCGATCAAGCTTCGTGATCGGACTCATAGAGAATCGAGCTAAGGAGGTTGGAGTGGCTGCTTTTGACTTAAGGTCAGCTTCACTTCACCTTTCGGAATACATTGAAACCAGCAGCTCATATCAAAACACAAAAACACTGCTGCATTTCTACGATCCAATGACAATTATTGTCCCTCCTAATAAGCTAGCACCTGATGGCATGGTTGGGGTATCAGAATTAGTTGATAAATTATATTCCTC...

CDS

Download CDS FASTA

2451 bp · LXL04_026608|LXL04_026608|OH1004|CDS

ATGGAAGACGACACGGGAGAGCGATCAAGCTTCGTGATCGGACTCATAGAGAATCGAGCTAAGGAGGTTGGAGTGGCTGCTTTTGACTTAAGGTCAGCTTCACTTCACCTTTCGGAATACATTGAAACCAGCAGCTCATATCAAAACACAAAAACACTGCTGCATTTCTACGATCCAATGACAATTATTGTCCCTCCTAATAAGCTAGCACCTGATGGCATGGTTGGGGTATCAGAATTAGTTGATAAATTATATTCCTC...

Protein

Download Protein FASTA

816 aa · LXL04_026608|LXL04_026608|OH1004|PROTEIN

MEDDTGERSSFVIGLIENRAKEVGVAAFDLRSASLHLSEYIETSSSYQNTKTLLHFYDPMTIIVPPNKLAPDGMVGVSELVDKLYSSIRKVTMLRGCFDDTKGAVLVKSLAAKEPSALGLDTYYKQYYLCLAAAAATIKWIEAEKGIIITNHSLLVTFNGSFDHLNIDATSVHNLEIIEPLHSTLLGTSNKKRSLFQTLKSTRTSGGSRLLRANLLQPLKDIETIKARLDCLDELMSNEELFFGLSQALQKFPKESDRVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026608`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026608

Location Chr05:129447158-129451904 (-)

Description Similar to MSH4: DNA mismatch repair protein MSH4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g17380`	Involved in meiotic recombination in association with MSH5.	The Arabidopsis MutS homolog AtMSH4 functions at an early step in recombination: evidence for two classes of recombination in Arabidopsis.2004 · DOI: 10.1101/gad.317504 Zip4/Spo22 is required for class I CO formation but not for synapsis completion in Arabidopsis thaliana.2007 · DOI: 10.1371/journal.pgen.0030083 Replication protein A (AtRPA1a) is required for class I crossover formation but is dispensable for meiotic DNA break repair.2009 · DOI: 10.1038/emboj.2008.295

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026608 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006298 mismatch repair Biological Process

GO:0007129 homologous chromosome pairing at meiosis Biological Process

GO:0007131 reciprocal meiotic recombination Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0007292 female gamete generation Biological Process

GO:0010777 meiotic mismatch repair involved in reciprocal meiotic recombination Biological Process

GO:0045143 homologous chromosome segregation Biological Process

GO:0051321 meiotic cell cycle Biological Process

GO:0000228 nuclear chromosome Cellular Component

GO:0000793 condensed chromosome Cellular Component

GO:0000794 condensed nuclear chromosome Cellular Component

GO:0000795 synaptonemal complex Cellular Component

KEGG gene cross-reference

ath:AT4G17380

cya:CYA_2035

hsa:4438

mmu:55993

sce:YFL003C

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.733

Rank 1 · LXL04_026608 · OH-1004

Cytoplasm0.260

Rank 2 · LXL04_026608 · OH-1004

Mitochondrion0.069

Rank 3 · LXL04_026608 · OH-1004

Cell membrane0.026

Rank 4 · LXL04_026608 · OH-1004

Endoplasmic reticulum0.012

Rank 5 · LXL04_026608 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05192.24MutS_III171-492 aa

PF05190.24MutS_IV363-454 aa

PF00488.28MutS_V550-612 aa

PF00488.28MutS_V634-761 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026608	`PF05192.24`	MutS_III	171	492	4e-25	90.0
LXL04_026608	`PF05190.24`	MutS_IV	363	454	2.8e-14	53.9
LXL04_026608	`PF00488.28`	MutS_V	550	612	5.8e-61	206.5
LXL04_026608	`PF00488.28`	MutS_V	634	761	5.8e-61	206.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JP48`	Arabidopsis thaliana	DNA mismatch repair protein MSH4	74.785%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card