TkA05G473210 | RubberDandelionOmics

Gene overview

TkA05G473210

Reference: TK1151 Chr: Chr05 Coordinates: 118754843-118756356 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1089 bp · TkA05G473210|TK1151|cDNA

CAGTATGCAATCTTGAGGGACTATGTCCTTGAAATACAAAAGACAAATCCGGGTACCACTGTGAAGATCGAGGTGGTCTCTGAACCAAATCCTTACTCCTCAACAAGGCAGTTTAAGAGGATATATGTGTGTCTAGGGGCTCTAAAGAAAGGTTTTAAGGCTGGTATTAGAGATTTTCTAGGCTTAGATGGAGCCTTTATGAAGGGACCATTCCCAGGTCAAATACTAACCGCAGTTGGGGTTGATTCAAATAATGGAAT...

CDS

Download CDS FASTA

1089 bp · TkA05G473210|TK1151|CDS

CAGTATGCAATCTTGAGGGACTATGTCCTTGAAATACAAAAGACAAATCCGGGTACCACTGTGAAGATCGAGGTGGTCTCTGAACCAAATCCTTACTCCTCAACAAGGCAGTTTAAGAGGATATATGTGTGTCTAGGGGCTCTAAAGAAAGGTTTTAAGGCTGGTATTAGAGATTTTCTAGGCTTAGATGGAGCCTTTATGAAGGGACCATTCCCAGGTCAAATACTAACCGCAGTTGGGGTTGATTCAAATAATGGAAT...

Protein

Download Protein FASTA

362 aa · TkA05G473210|TK1151|PROTEIN

QYAILRDYVLEIQKTNPGTTVKIEVVSEPNPYSSTRQFKRIYVCLGALKKGFKAGIRDFLGLDGAFMKGPFPGQILTAVGVDSNNGIYPLAYAVVESENTSSWKWFLECLGEDLELYSNSNFTFVTDRQNGLDRAIGDLFPHAEHRYCVRHIYQNMRREWKATEYKDFLWKRAISDMLLNNLCEVFNSKLVKGRDKPIISCLEFIREYLMKRVVNVMKVLRKSAGPLTPTGNRLLEKWELTGIPCKHAIATLFEMAKYGE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G473210`
TK1151 ID	TkA05G473210
OH-1004 ID	LXL04_036067
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	77.900
Protein coverage (%)	TK1151 100.000 / OH-1004 65.050 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G473210`
Location	Chr05:118754843-118756356 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_036067` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006355 regulation of DNA-templated transcription Biological Process GO:0005634 nucleus Cellular Component GO:0008270 zinc ion binding Molecular Function
KEGG gene cross-reference	ath:AT1G52520 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.883

Rank 1 · TkA05G473210 · TK1151

Cytoplasm0.144

Rank 2 · TkA05G473210 · TK1151

Endoplasmic reticulum0.037

Rank 3 · TkA05G473210 · TK1151

Cell membrane0.035

Rank 4 · TkA05G473210 · TK1151

Extracellular0.023

Rank 5 · TkA05G473210 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10551MULE60-155 aa

PF00872Transposase_mut75-164 aa

PF04434SWIM237-252 aa

PF27939DUF8363341-358 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G473210	`PF10551`	MULE	60	155	4.1e-20	72.7
TkA05G473210	`PF00872`	Transposase_mut	75	164	8e-06	25.7
TkA05G473210	`PF04434`	SWIM	237	252	0.0016	18.7
TkA05G473210	`PF27939`	DUF8363	341	358	0.16	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card