TkA05G449800 | RubberDandelionOmics

Gene overview

TkA05G449800

Reference: TK1151 Chr: Chr05 Coordinates: 112453870-112456453 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1670 bp · TkA05G449800|TK1151|cDNA

ACAGTTGAGGGACTGATGATGTAAATTGGGACTTTTATTAGTTTGCTCGCAACTCGCAAGAGGAGGCTGCCCCTGTGAAGAAGCTCCTATATATCCCTCTTCGTTTGGGGGAAAATGCTTATGAAATCAAGTGGTTTACTGCTTTCTCGCATCCCTATCATTCCTTCCTCCTTCCGAAGAAGTAAGATTTGTATGAAAAAAATGAGCACGAAGGATATGGCTTCAGCTACAGCTACAGCTACACCAATTTACCCTAAATT...

CDS

Download CDS FASTA

1152 bp · TkA05G449800|TK1151|CDS

ATGCTTATGAAATCAAGTGGTTTACTGCTTTCTCGCATCCCTATCATTCCTTCCTCCTTCCGAAGAAGTAAGATTTGTATGAAAAAAATGAGCACGAAGGATATGGCTTCAGCTACAGCTACAGCTACACCAATTTACCCTAAATTTATTCCAGTAGAGCAGAATGAAATTACTTCAGTTAGCAAGTCTGAGGGCATTAAATTTCGAGTGGTTTCATATAACATTCTGGCTCAGGTTTATGTAAAAAGCTCTGTATTCCC...

Protein

Download Protein FASTA

383 aa · TkA05G449800|TK1151|PROTEIN

MLMKSSGLLLSRIPIIPSSFRRSKICMKKMSTKDMASATATATPIYPKFIPVEQNEITSVSKSEGIKFRVVSYNILAQVYVKSSVFPHSPSPCLKWKARSPIILDVLKHLDADILCLQELDEYDNFYKEKIEQNDYSSIYIKRSGRKSDGCGIFYKHNKLELVTEDTIDYNDLANLLLDESSQKKKDLDSNKEKGDPNDPYVRLKRDCIGIMAAFKFKKPYQHYVIIANTHLYWDPEWADVKLAQAKYLLKRVTQFKKMV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G449800`
TK1151 ID	TkA05G449800
OH-1004 ID	LXL04_000443
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	28.300
Protein coverage (%)	TK1151 81.723 / OH-1004 45.479 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G449800

Location Chr05:112453870-112456453 (-)

Description Similar to CCR4-1: Carbon catabolite repressor protein 4 homolog 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g31500`	Acts as a catalytic component of the CCR4-NOT core complex, which in the nucleus seems to be a general transcription factor, and in the cytoplasm the major mRNA deadenylase involved in mRNA turnover (By similarity).	AtHESPERIN: a novel regulator of circadian rhythms with poly(A)-degrading activity in plants.2016 · DOI: 10.1080/15476286.2015.1119363

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000443 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000076 DNA replication checkpoint signaling Biological Process

GO:0000289 nuclear-transcribed mRNA poly(A) tail shortening Biological Process

GO:0005986 sucrose biosynthetic process Biological Process

GO:0006260 DNA replication Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006368 transcription elongation by RNA polymerase II Biological Process

GO:0006397 mRNA processing Biological Process

GO:0006417 regulation of translation Biological Process

GO:0007089 traversing start control point of mitotic cell cycle Biological Process

GO:0010629 negative regulation of gene expression Biological Process

GO:0019252 starch biosynthetic process Biological Process

GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process

KEGG gene cross-reference

ath:AT3G58560

ath:AT3G58580

dre:553665

spo:2538913

uma:UMAG_10379

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.349

Rank 1 · TkA05G449800 · TK1151

Mitochondrion0.333

Rank 2 · TkA05G449800 · TK1151

Peroxisome0.164

Rank 3 · TkA05G449800 · TK1151

Nucleus0.162

Rank 4 · TkA05G449800 · TK1151

Plastid0.094

Rank 5 · TkA05G449800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03372Exo_endo_phos72-373 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G449800	`PF03372`	Exo_endo_phos	72	373	8e-17	62.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A8MS41`	Arabidopsis thaliana	sp\|A8MS41\|CCR4D_ARATH Carbon catabolite repressor protein 4 homolog 4	62.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card