Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1289 bp · TkA05G447890|TK1151|cDNA
AAGAGAAATAAATAATAATATGGAACCTGCTTTGGGCCACCCGTCCATATAAAGCCGTAGGTAAAAGCATTTCTTCTACTACGTGCCATTGTCGACTCACTACCACCACCACCACCGCCACCACGAGGCAGCTTCTGCAGTCACTCAAGGAGTTATGACTACCATGGCTGCTGCTGATGTAACAGTTGCACCGATGACAATGGCGGATGAGCAGCAACAGCTCAAGAAAGGAATAGCCGAATTCTACGACGAGTCTTCGG...
927 bp · TkA05G447890|TK1151|CDS
ATGACTACCATGGCTGCTGCTGATGTAACAGTTGCACCGATGACAATGGCGGATGAGCAGCAACAGCTCAAGAAAGGAATAGCCGAATTCTACGACGAGTCTTCGGAGATGTGGGAGAATATATGGGGAGAACACATGCATCACGGATTCTACGACAACGACGCCGTCGTTGAACTCTCCGACCACCGCGCTGCTCAGATCCGAATGATCGAACAAAGCCTACTTTTCGCCTCTCTTCCTGATGATTCAGTGAAGAAACC...
Protein
Download Protein FASTA308 aa · TkA05G447890|TK1151|PROTEIN
MTTMAAADVTVAPMTMADEQQQLKKGIAEFYDESSEMWENIWGEHMHHGFYDNDAVVELSDHRAAQIRMIEQSLLFASLPDDSVKKPKTIVDVGCGIGGSSRYLAKKYGAECHGITLSPVQAERAQALAASQGLADKVSFQVADALNQPFPDGKFDLVWSMESGEHMPDKLKFVSELARVAAPGATIIIVTWCHRDLLPTEKSLRPEEEKILNKICSGFYLPAWCSTADYIKLLESLSLQDIKAADWSGNVAPFWPAVIK...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA05G447890 |
|---|---|
| TK1151 ID | TkA05G447890 |
| OH-1004 ID | LXL04_012833 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 81.000 |
| Protein coverage (%) | TK1151 95.779 / OH-1004 86.217Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA05G447890 | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr05:111996422-111998760 (-) | ||||||||||||
| Description | Similar to VTE4: Probable tocopherol O-methyltransferase, chloroplastic | ||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| ||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||||||||
| GO annotations (OH1004 source) | GO:0009820 alkaloid metabolic process Biological Process GO:0009821 alkaloid biosynthetic process Biological Process GO:0010189 vitamin E biosynthetic process Biological Process GO:0032259 methylation Biological Process GO:1900985 vindoline biosynthetic process Biological Process GO:0005634 nucleus Cellular Component GO:0009507 chloroplast Cellular Component GO:0009705 plant-type vacuole membrane Cellular Component GO:0009706 chloroplast inner membrane Cellular Component GO:0008168 methyltransferase activity Molecular Function GO:0008170 N-methyltransferase activity Molecular Function GO:0008757 S-adenosylmethionine-dependent methyltransferase activity Molecular Function | ||||||||||||
| KEGG gene cross-reference | ath:AT1G64970 dosa:Os02g0701600 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF02353CMAS4-29 aaPF02353CMAS23-188 aaPF00891Methyltransf_233-154 aaPF09445Methyltransf_1547-80 aaPF13489Methyltransf_2374-198 aaPF05175MTS74-158 aaPF13679Methyltransf_3282-145 aaPF01209Ubie_methyltran83-197 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA05G447890 | PF02353 | CMAS | 4 | 29 | 1.9e-13 | 51.1 |
| TkA05G447890 | PF02353 | CMAS | 23 | 188 | 1.9e-13 | 51.1 |
| TkA05G447890 | PF00891 | Methyltransf_2 | 33 | 154 | 0.028 | 14.5 |
| TkA05G447890 | PF09445 | Methyltransf_15 | 47 | 80 | 0.081 | 13.2 |
| TkA05G447890 | PF13489 | Methyltransf_23 | 74 | 198 | 2.9e-14 | 53.8 |
| TkA05G447890 | PF05175 | MTS | 74 | 158 | 0.0099 | 16.2 |
| TkA05G447890 | PF13679 | Methyltransf_32 | 82 | 145 | 0.0031 | 18.2 |
| TkA05G447890 | PF01209 | Ubie_methyltran | 83 | 197 | 1.7e-06 | 28.3 |
| TkA05G447890 | PF01728 | FtsJ | 84 | 158 | 0.0093 | 16.6 |
| TkA05G447890 | PF07021 | MetW | 84 | 162 | 0.15 | 12.4 |
| TkA05G447890 | PF13847 | Methyltransf_31 | 86 | 209 | 2.1e-16 | 60.7 |
| TkA05G447890 | PF09445 | Methyltransf_15 | 88 | 147 | 0.081 | 13.2 |
| TkA05G447890 | PF13649 | Methyltransf_25 | 90 | 184 | 1.4e-20 | 74.5 |
| TkA05G447890 | PF08241 | Methyltransf_11 | 91 | 189 | 8.5e-22 | 78.3 |
| TkA05G447890 | PF08242 | Methyltransf_12 | 91 | 186 | 1.4e-12 | 48.9 |
| TkA05G447890 | PF29244 | Methyltransf_ANTKMT | 92 | 189 | 2.5e-06 | 28.6 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.