TkA05G441470 | RubberDandelionOmics

Gene overview

TkA05G441470

Reference: TK1151 Chr: Chr05 Coordinates: 110229940-110241117 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1348 bp · TkA05G441470|TK1151|cDNA

ATGCTTCATCACTTCAGCTCCAGCGGAGCTTCATTTATTCGCAATGCCGATCTAAGATGTCATTTGCTTCATCAGGGCTTTACAGAGGTTGCTGATGAACTTGATTATAGGAACGAATTTAGACAGATGACATCGGAAAAAACTCTTTCTATAAACCTTGGTGTAGAAGCTCAGGTTGTGACCATTGAACAAGCAAGTGTTGAAGCTAAGGAATCTGCAGTACGCGAGGTTGCGAAGCTCTTGCCGCTTTCTGAGCTTTT...

CDS

Download CDS FASTA

975 bp · TkA05G441470|TK1151|CDS

ATGCTTCATCACTTCAGCTCCAGCGGAGCTTCATTTATTCGCAATGCCGATCTAAGATGTCATTTGCTTCATCAGGGCTTTACAGAGGTTGCTGATGAACTTGATTATAGGAACGAATTTAGACAGATGACATCGGAAAAAACTCTTTCTATAAACCTTGGTGTAGAAGCTCAGGTTGTGACCATTGAACAAGCAAGTGTTGAAGCTAAGGAATCTGCAGTACGCGAGGTTGCGAAGCTCTTGCCGCTTTCTGAGCTTTT...

Protein

Download Protein FASTA

324 aa · TkA05G441470|TK1151|PROTEIN

MLHHFSSSGASFIRNADLRCHLLHQGFTEVADELDYRNEFRQMTSEKTLSINLGVEAQVVTIEQASVEAKESAVREVAKLLPLSELLISISSIKAEMSIKLTYFFTLNRATDAQLSTMVAEQVEQAQAGLKALGSSEENDVEGMMSISSEAAAAHDSLSDDKELINTYDRLTALDGKRRFALAAASTHEEEVGRLRLYFEEVDRTWETFEQTLWSHISNFFQLAKESPQTLVRALRLFLDLGMEFLEKQIPDTQVKNPWP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G441470`
TK1151 ID	TkA05G441470
OH-1004 ID	LXL04_002566
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	70.200
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G441470

Location Chr05:110229940-110241117 (+)

Description Similar to SEC6: Exocyst complex component SEC6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g71820`	Component of the exocyst complex involved in the docking of exocytic vesicles with fusion sites on the plasma membrane during regulated or polarized secretion.	The Arabidopsis exocyst complex is involved in cytokinesis and cell plate maturation.2010 · DOI: 10.1105/tpc.110.074351 Visualization of the exocyst complex dynamics at the plasma membrane of Arabidopsis thaliana.2013 · DOI: 10.1091/mbc.e12-06-0492 Regulation of cytokinesis by exocyst subunit SEC6 and KEULE in Arabidopsis thaliana.2013 · DOI: 10.1093/mp/sst082
`At2g44350`	Citrate synthase 4, mitochondrial.	No verified direct reference in this release
`At3g60100`	Citrate synthase 5, mitochondrial.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_002566 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006099 tricarboxylic acid cycle Biological Process

GO:0006101 citrate metabolic process Biological Process

GO:0006887 exocytosis Biological Process

GO:0051601 exocyst localization Biological Process

GO:0060321 acceptance of pollen Biological Process

GO:0000145 exocyst Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G71820

ath:AT2G44350

sot:102595372

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.470

Rank 1 · TkA05G441470 · TK1151

Nucleus0.398

Rank 2 · TkA05G441470 · TK1151

Mitochondrion0.105

Rank 3 · TkA05G441470 · TK1151

Cell membrane0.087

Rank 4 · TkA05G441470 · TK1151

Golgi apparatus0.063

Rank 5 · TkA05G441470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20640Rrn6_HB68-91 aa

PF20640Rrn6_HB103-172 aa

PF06046Sec6114-128 aa

PF00285Citrate_synt171-240 aa

PF06046Sec6199-236 aa

PF00285Citrate_synt247-311 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G441470	`PF20640`	Rrn6_HB	68	91	0.4	11.2
TkA05G441470	`PF20640`	Rrn6_HB	103	172	0.4	11.2
TkA05G441470	`PF06046`	Sec6	114	128	2.1e-05	24.0
TkA05G441470	`PF00285`	Citrate_synt	171	240	5.2e-12	46.2
TkA05G441470	`PF06046`	Sec6	199	236	2.1e-05	24.0
TkA05G441470	`PF00285`	Citrate_synt	247	311	5.2e-12	46.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94AI6`	Arabidopsis thaliana	sp\|Q94AI6\|SEC6_ARATH Exocyst complex component SEC6	56.800%	Swiss-Prot	Medium
`P20115`	Arabidopsis thaliana	sp\|P20115\|CISY4_ARATH Citrate synthase 4, mitochondrial	88.700%	Swiss-Prot	Low
`Q9M1D3`	Arabidopsis thaliana	sp\|Q9M1D3\|CISY5_ARATH Citrate synthase 5, mitochondrial	91.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card