TkA05G421600 | RubberDandelionOmics

Gene overview

TkA05G421600

Reference: TK1151 Chr: Chr05 Coordinates: 105067762-105070495 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

570 bp · TkA05G421600|TK1151|cDNA

ATGAACAGTTTCGCAGTGAACATGCGAATTTCGCAAACAGCTTTTCTTGTACAGCGAATCCCATCGGCGATCTATCCTCAGTTTAACTGCATGATCTTCATGATTTCAACAAGCATTGGTACATCTTCTGTTTCCTGTAAAGCGGGAAACAAGAACAACTTCCCTTTCTGGATTCCCATTTACCTATTTTCAAGATTCTCTGGGATTCAATGGCTTTACAAGAGCTTGAAGAATCTCCTTTTTGTTGATGTTGTTGATGA...

CDS

Download CDS FASTA

570 bp · TkA05G421600|TK1151|CDS

ATGAACAGTTTCGCAGTGAACATGCGAATTTCGCAAACAGCTTTTCTTGTACAGCGAATCCCATCGGCGATCTATCCTCAGTTTAACTGCATGATCTTCATGATTTCAACAAGCATTGGTACATCTTCTGTTTCCTGTAAAGCGGGAAACAAGAACAACTTCCCTTTCTGGATTCCCATTTACCTATTTTCAAGATTCTCTGGGATTCAATGGCTTTACAAGAGCTTGAAGAATCTCCTTTTTGTTGATGTTGTTGATGA...

Protein

Download Protein FASTA

189 aa · TkA05G421600|TK1151|PROTEIN

MNSFAVNMRISQTAFLVQRIPSAIYPQFNCMIFMISTSIGTSSVSCKAGNKNNFPFWIPIYLFSRFSGIQWLYKSLKNLLFVDVVDDDDDDYDGSLDYTLASMLLRPGPICALLNAQFPEVNEDVKNVPRVYIKTLYDRVVKPEQQEKMIAKWPPSHVYSLESDHSPNFSSPFALFGLLVKVAASVGCT

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G421600`
TK1151 ID	TkA05G421600
OH-1004 ID	LXL04_021794
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	63.900
Protein coverage (%)	TK1151 85.185 / OH-1004 71.429 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G421600

Location Chr05:105067762-105070495 (-)

Description Similar to MES17: Methylesterase 17

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g10870`	Methylesterase that efficiently and specifically hydrolyzes methyl indole-3-acetic acid (MeIAA) to IAA (auxin).	Inactive methyl indole-3-acetic acid ester can be hydrolyzed and activated by several esterases belonging to the AtMES esterase family of Arabidopsis.2008 · DOI: 10.1104/pp.108.118224

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021794 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009694 jasmonic acid metabolic process Biological Process

GO:0009696 salicylic acid metabolic process Biological Process

GO:0010150 leaf senescence Biological Process

GO:0015996 chlorophyll catabolic process Biological Process

GO:0031408 oxylipin biosynthetic process Biological Process

GO:0033310 chlorophyll a catabolic process Biological Process

GO:0033473 indoleacetic acid conjugate metabolic process Biological Process

GO:0045727 positive regulation of translation Biological Process

KEGG gene cross-reference

ag:BAE54383

ath:AT3G08720

ath:AT3G10870

ath:AT4G16690

ath:AT5G58310

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.318

Rank 1 · TkA05G421600 · TK1151

Nucleus0.232

Rank 2 · TkA05G421600 · TK1151

Endoplasmic reticulum0.183

Rank 3 · TkA05G421600 · TK1151

Mitochondrion0.109

Rank 4 · TkA05G421600 · TK1151

Lysosome / Vacuole0.107

Rank 5 · TkA05G421600 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SG92`	Arabidopsis thaliana	sp\|Q9SG92\|MES17_ARATH Methylesterase 17	60.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card